ID: 1043053257

View in Genome Browser
Species Human (GRCh38)
Location 8:75407456-75407478
Sequence CGCTGCGGTCTCGGGAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043053246_1043053257 -1 Left 1043053246 8:75407434-75407456 CCCCGCGGAGGCCCGGGAGAGCC No data
Right 1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG No data
1043053248_1043053257 -3 Left 1043053248 8:75407436-75407458 CCGCGGAGGCCCGGGAGAGCCGC No data
Right 1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG No data
1043053242_1043053257 10 Left 1043053242 8:75407423-75407445 CCGCCTGGCTGCCCCGCGGAGGC No data
Right 1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG No data
1043053247_1043053257 -2 Left 1043053247 8:75407435-75407457 CCCGCGGAGGCCCGGGAGAGCCG No data
Right 1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG No data
1043053243_1043053257 7 Left 1043053243 8:75407426-75407448 CCTGGCTGCCCCGCGGAGGCCCG No data
Right 1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043053257 Original CRISPR CGCTGCGGTCTCGGGAGGCC GGG Intergenic
No off target data available for this crispr