ID: 1043056166

View in Genome Browser
Species Human (GRCh38)
Location 8:75442463-75442485
Sequence CTGTGGAAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043056158_1043056166 11 Left 1043056158 8:75442429-75442451 CCCAGCGCAATGGCTCATGCCTA 0: 2
1: 75
2: 1606
3: 14299
4: 56816
Right 1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
1043056159_1043056166 10 Left 1043056159 8:75442430-75442452 CCAGCGCAATGGCTCATGCCTAT 0: 1
1: 36
2: 393
3: 1730
4: 3940
Right 1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
1043056161_1043056166 -8 Left 1043056161 8:75442448-75442470 CCTATAATCTCAGCACTGTGGAA 0: 3
1: 153
2: 4799
3: 64732
4: 358696
Right 1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043056166 Original CRISPR CTGTGGAAGGCCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr