ID: 1043058567

View in Genome Browser
Species Human (GRCh38)
Location 8:75471600-75471622
Sequence TTGGAAATTAATAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 480}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043058567_1043058572 11 Left 1043058567 8:75471600-75471622 CCTTCCTTCTTATTAATTTCCAA 0: 1
1: 0
2: 1
3: 53
4: 480
Right 1043058572 8:75471634-75471656 TTCTTTTAAAGGAGGCAGTTTGG No data
1043058567_1043058570 0 Left 1043058567 8:75471600-75471622 CCTTCCTTCTTATTAATTTCCAA 0: 1
1: 0
2: 1
3: 53
4: 480
Right 1043058570 8:75471623-75471645 TTTATCTTTCTTTCTTTTAAAGG No data
1043058567_1043058573 19 Left 1043058567 8:75471600-75471622 CCTTCCTTCTTATTAATTTCCAA 0: 1
1: 0
2: 1
3: 53
4: 480
Right 1043058573 8:75471642-75471664 AAGGAGGCAGTTTGGTGTGATGG No data
1043058567_1043058571 3 Left 1043058567 8:75471600-75471622 CCTTCCTTCTTATTAATTTCCAA 0: 1
1: 0
2: 1
3: 53
4: 480
Right 1043058571 8:75471626-75471648 ATCTTTCTTTCTTTTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043058567 Original CRISPR TTGGAAATTAATAAGAAGGA AGG (reversed) Intronic
900500858 1:3003844-3003866 TTTGACAATAATGAGAAGGAAGG - Intergenic
902675730 1:18007465-18007487 TTGGATATTCATGGGAAGGATGG - Intergenic
903346893 1:22691387-22691409 TTGGAACATAACAAGAAGTAAGG - Intergenic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
904402628 1:30266861-30266883 TTAGAAATAAATAAGGAGGCTGG - Intergenic
905376684 1:37526359-37526381 TGGGAAATTAATTAGATGTAAGG - Intergenic
905698963 1:39997436-39997458 GTGATAATTAATAAGTAGGAGGG + Intergenic
906159232 1:43635435-43635457 TTAAAAAATAATAATAAGGAGGG + Intergenic
906534267 1:46543158-46543180 TTGGAAATCTGAAAGAAGGAAGG - Intergenic
906594299 1:47060992-47061014 TTTGAAACTAATAAGAACAAAGG + Intergenic
906597934 1:47096480-47096502 TTGGAAATCAAAAAGAAAAAAGG - Intronic
906835730 1:49081928-49081950 TTGGCATTTAAAAAGAAGGCTGG + Intronic
907535685 1:55153877-55153899 TTGGAAAAAAACAAGAAGGATGG - Exonic
907849626 1:58243151-58243173 TTGGAAAGTGACAGGAAGGAGGG - Intronic
908368812 1:63458654-63458676 TTGGAAGTTACAAAAAAGGAGGG - Intronic
908640571 1:66218413-66218435 TTGGAAAGTACAAAGAAGGGAGG + Intronic
908666877 1:66502839-66502861 CTGGGAAATAAAAAGAAGGAAGG + Intergenic
908769983 1:67587150-67587172 TTGGAAATTAGAAAGAATGCAGG - Intergenic
908884884 1:68777664-68777686 TTAGAACTTAATAAGTAAGAAGG + Intergenic
910113438 1:83706072-83706094 TTGTAAATTGAAAAGAAGAACGG + Intergenic
910187214 1:84557228-84557250 TTTGCAATTAATAAAAAAGAGGG + Intronic
911055232 1:93702812-93702834 CTGGAAATTAAAAACAAGGTAGG - Intronic
911452599 1:98083903-98083925 TTGGCATTTAATAGGAAGAAGGG - Intergenic
912638675 1:111322655-111322677 TTGGAAAGTGATAATAGGGATGG + Intergenic
913034061 1:114943857-114943879 ATAGAAATTATTAAGAGGGAAGG - Intronic
913145562 1:115986467-115986489 TTGGAAATTAAGAAGGGAGACGG + Intronic
913280815 1:117183230-117183252 TTGAAAAATAATAGGAACGAAGG - Intronic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913576094 1:120176615-120176637 TTGGAAGTTAAGAAGGTGGAAGG - Intergenic
914932043 1:151943656-151943678 TTGGAAATTTCTAAAAAGGAAGG - Intergenic
915607281 1:156960583-156960605 TTGGAGAGTGATGAGAAGGATGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918558034 1:185828699-185828721 CTAGAAATTAATAACAAGGGAGG + Intronic
918611133 1:186493594-186493616 TTCTAAAGTATTAAGAAGGAAGG + Intergenic
921089292 1:211828673-211828695 TTGGAAATTTAGAAAAAGAATGG - Intronic
921950036 1:220920014-220920036 TTAGGTATTAATAAGAAAGAGGG + Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
924374687 1:243392996-243393018 TTGAAAATTAATAATAAAAAAGG + Intronic
1063475127 10:6321613-6321635 TAGGAAGTTAGCAAGAAGGAGGG - Intergenic
1063750352 10:8937359-8937381 TTGAAAATTAATAACAAAGTTGG - Intergenic
1063912763 10:10848996-10849018 TTGCAATTTCAGAAGAAGGACGG - Intergenic
1063969650 10:11372702-11372724 TTGGAAATTAAGAAGATCAAAGG - Intergenic
1064777378 10:18793899-18793921 TTTGAATTTAGAAAGAAGGAAGG + Intergenic
1064882057 10:20066452-20066474 ATGGAAATAAATTAGAATGATGG + Intronic
1065139672 10:22708145-22708167 TTGGAAGGTAAGTAGAAGGAAGG - Intronic
1065755951 10:28931274-28931296 TTCCAGATTAAGAAGAAGGAGGG - Intergenic
1065771025 10:29078691-29078713 TAGAAAATTATTTAGAAGGAAGG - Intergenic
1065968593 10:30788083-30788105 TTGGAAATTAATAACCTGAAGGG - Intergenic
1066150707 10:32613613-32613635 TTGGAAACAAATGAGAAGAAAGG - Intronic
1066533857 10:36369139-36369161 ATGGAAAGTAATAGGAAGGAAGG + Intergenic
1067362100 10:45591952-45591974 ATGGAAATTGAGAGGAAGGATGG - Intronic
1068260146 10:54570126-54570148 GTGGAAATTCATAAGGAGAATGG + Intronic
1068289032 10:54977669-54977691 TTGGAAAATAAAAAAAATGAAGG - Intronic
1068325558 10:55481534-55481556 TTTGAAACTAATGAGAAGAAAGG - Intronic
1068336881 10:55644846-55644868 ATGGAAATTAATAATATGTATGG + Intergenic
1068541992 10:58305110-58305132 TTGGAAAATAATTACAAAGATGG - Intergenic
1072169552 10:92846666-92846688 TTCCAGATTAATAGGAAGGAGGG + Intronic
1072327011 10:94308808-94308830 ATGGAAATTAATAACAATAATGG + Intronic
1072469388 10:95698164-95698186 TTGCCAATTTATAACAAGGATGG - Intergenic
1073264352 10:102216085-102216107 TCTGAAATTAATCAGAAGAAAGG - Intergenic
1074383345 10:112997705-112997727 ATGGAAATTACTCAGAAGGAAGG - Intronic
1075510586 10:123069566-123069588 CAGGAAATTAATCAGAGGGACGG - Intergenic
1078077538 11:8175392-8175414 TTGGAAAATAAAAATAAGGTGGG + Intergenic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1079347990 11:19669742-19669764 TTGGAATTTACTAAGAGGAAAGG - Intronic
1079763844 11:24364822-24364844 ATGGAAATTAAATATAAGGAAGG + Intergenic
1079888604 11:26021261-26021283 GTGTAAATTAAGTAGAAGGAAGG + Intergenic
1079995121 11:27287621-27287643 TTGAAAATTAAAAAGAGAGAAGG - Intergenic
1080578478 11:33622064-33622086 TTTGAAAATGTTAAGAAGGATGG + Intronic
1080817133 11:35769452-35769474 TTGTAAATTAAAAAGAAACAAGG - Intronic
1081194443 11:40143948-40143970 ATGGAGATTACTAAGTAGGAAGG + Intronic
1082222548 11:49657632-49657654 TTGCAATTTAATGAGAAGTATGG - Intergenic
1083065622 11:59921218-59921240 TTGGAGAGTAATAAGAATGAAGG - Intergenic
1084906314 11:72350595-72350617 CAGGAAATCAATAAAAAGGAAGG + Intronic
1086263233 11:84966495-84966517 TTGGAAAGTATTATAAAGGAAGG + Intronic
1086626500 11:88961574-88961596 TTGCAATTTAATGAGAAGTATGG + Intronic
1086729119 11:90226682-90226704 TTTGAATTTTATAAGAAAGACGG + Intergenic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1087828777 11:102796322-102796344 GTGGAAATTAAAGAAAAGGAAGG - Intronic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088540451 11:110908317-110908339 GAGGAAAATAAAAAGAAGGATGG + Intergenic
1089005865 11:115090332-115090354 TTTGAAACTATCAAGAAGGAAGG + Intergenic
1089084606 11:115806392-115806414 TTGGAAATAAATAAAGATGAAGG + Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1091965882 12:4741248-4741270 TTGGAAATAAAAAAAGAGGAAGG - Intronic
1093060276 12:14595098-14595120 GTGGAAAAAAAAAAGAAGGAAGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1093913350 12:24772415-24772437 TTGGCAAGTTCTAAGAAGGATGG + Intergenic
1095607641 12:44089176-44089198 TTTGAAATGAATGAAAAGGAAGG + Intronic
1096704376 12:53409702-53409724 TGGAAAATTTTTAAGAAGGAAGG + Intronic
1097575142 12:61383355-61383377 TTGGAAATTCTGGAGAAGGAAGG + Intergenic
1097945283 12:65360925-65360947 TTGGAAATGTTTAAGAGGGAAGG - Intronic
1098885055 12:75952507-75952529 TTGGAAATAAAGAAAAAAGAGGG - Intergenic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1099559185 12:84150669-84150691 TTGCACAATAATAAAAAGGAAGG - Intergenic
1099763554 12:86952160-86952182 TTCAAAATTAATAAGAAGGCAGG + Intergenic
1099883728 12:88501168-88501190 TTGGAAAATGAAAAGAAGGAGGG - Intronic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100320781 12:93489834-93489856 TGGGTATTAAATAAGAAGGAAGG - Intronic
1101430852 12:104625792-104625814 TTGGAAATGAAAAAGAAGACAGG - Intronic
1102860704 12:116333795-116333817 TTGGAAATTATTTAGAGGGAAGG - Intergenic
1103535296 12:121629765-121629787 TTGGAAATCTATAGGAGGGATGG + Intronic
1103855567 12:123967392-123967414 TTGCACATTGATAAGAAAGATGG - Intronic
1104261219 12:127183906-127183928 TTGTAACTTAGTAAGAAGGTAGG + Intergenic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1105566789 13:21557252-21557274 TGGGAAGTGAATAAGAATGAAGG + Intronic
1105809139 13:23979450-23979472 TTGCATATTCATAAGAAGGCGGG - Intergenic
1106382947 13:29257534-29257556 TTGGAACTTAACGTGAAGGAGGG + Intronic
1106932061 13:34677095-34677117 CTAGTAATTAATAAGGAGGAGGG - Intergenic
1107714413 13:43185448-43185470 TTGGAAATCACTAAGAAGAAGGG - Intergenic
1108088854 13:46824560-46824582 TTGGACATTAATAAAAATAAAGG - Intergenic
1109448937 13:62483423-62483445 TTGGGGACTAAAAAGAAGGATGG - Intergenic
1109594766 13:64536095-64536117 TTGGAAATAAAAAATAAGCAGGG + Intergenic
1109853203 13:68095133-68095155 TTTGAAACTAATAAAAAGTAAGG + Intergenic
1110164102 13:72417053-72417075 TTGGGAATTAGTAAGAACTAAGG - Intergenic
1110970600 13:81756649-81756671 TTGGAAAGTGATCAGAAGTAAGG + Intergenic
1111184692 13:84718292-84718314 TTGTAAATAAATAAGAAGCCAGG - Intergenic
1111195078 13:84864808-84864830 TTGTAAATTAATAAGACTGGGGG + Intergenic
1111209548 13:85060154-85060176 ATGAAAATTAAAAAGAAGGCCGG + Intergenic
1111401553 13:87743096-87743118 TTGGAAAGTAAAAGGAAGGATGG + Intergenic
1111466254 13:88615173-88615195 TTGTAAATTAAAAAGAGGTAAGG - Intergenic
1111623406 13:90752895-90752917 TCAGAAGATAATAAGAAGGAGGG + Intergenic
1111938727 13:94585858-94585880 TTGGAAATTAAATAGGAAGAGGG + Intronic
1112885300 13:104162968-104162990 TTGGAAATTGGTACCAAGGAGGG + Intergenic
1112928708 13:104709346-104709368 TTGGAAAGTAATACTAAGAAAGG - Intergenic
1113020219 13:105876819-105876841 TGAGAAATTCAAAAGAAGGAAGG - Intergenic
1113391016 13:109897151-109897173 TTGCAAATAAATCAGAAAGAAGG + Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1114531262 14:23397879-23397901 GTGGAAAGATATAAGAAGGAAGG - Intronic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114979938 14:28150163-28150185 TTATAAATTACTAAGAAGAAAGG + Intergenic
1115297513 14:31845841-31845863 TTGGAGAAAAATAAGAAGGGAGG - Intronic
1115627569 14:35209351-35209373 ATGGAAATTTATGAGGAGGAAGG - Intronic
1116093914 14:40343025-40343047 AAGAAAATTAACAAGAAGGAAGG - Intergenic
1116462894 14:45198055-45198077 TTTCAAATTAAAAAGAAGGCTGG - Intronic
1116785129 14:49279889-49279911 TTGGAAATTAATCAGATGTATGG + Intergenic
1117229795 14:53705101-53705123 TTTGAATTAAATAAGAAGGAGGG + Intergenic
1117427197 14:55612917-55612939 TTGGATATTTATAAGATGTATGG - Intronic
1117790878 14:59340733-59340755 TTGGAACTTGAAAAGAAGAAAGG + Intronic
1117823141 14:59672495-59672517 TTCAAAATTAATATCAAGGAAGG + Intronic
1118716948 14:68566853-68566875 TTGAAGAGTAATAAGAAAGAAGG - Intronic
1120123787 14:80715657-80715679 ACGGAAATTAGTAAAAAGGAGGG + Intronic
1121146638 14:91589605-91589627 TTGGAAATTATCAACGAGGATGG - Exonic
1123388073 15:19839394-19839416 TGGGATACTAATAAGAAGGAAGG + Intergenic
1123767908 15:23500208-23500230 TTGGAAAAAAATAAGAAAGCTGG + Intergenic
1123794685 15:23759998-23760020 TTGGAAATTAAACATAAGCATGG + Intergenic
1123823039 15:24050855-24050877 ATAGAAAATAATAAGAATGAGGG - Intergenic
1124824424 15:33079744-33079766 CTGGAAATTGATGTGAAGGATGG - Intronic
1125179048 15:36860404-36860426 TTGGAGATAAATAAGAGGAAAGG + Intergenic
1125376076 15:39030975-39030997 GTAGAAACTCATAAGAAGGAAGG - Intergenic
1125382383 15:39100631-39100653 GAGGAAATTAAGAAGAATGAGGG + Intergenic
1126157483 15:45578796-45578818 TTGCAAAATAATTAAAAGGAAGG - Intergenic
1126179552 15:45771620-45771642 TTGGACATTAATAAAAGGAAGGG - Intergenic
1126371432 15:47951199-47951221 TGGGAAAATAAATAGAAGGAAGG + Intergenic
1126927954 15:53612113-53612135 TTGGAGATAAATAAGATAGATGG - Intronic
1127716889 15:61656899-61656921 ATGGGAAATAATAAGAAGTAAGG - Intergenic
1128660726 15:69499253-69499275 TTTGCAATTAAAAAGGAGGAAGG - Intergenic
1129027682 15:72593742-72593764 TTGAAAAATAACAAAAAGGAAGG - Exonic
1129143568 15:73625768-73625790 TTTTAAATTAATAAGTAGCAAGG + Intronic
1129712928 15:77830180-77830202 CTGGAAGTCAAGAAGAAGGAAGG + Intergenic
1129922414 15:79330935-79330957 TTGGTAATTCATAAGAAAAAAGG + Intronic
1130079028 15:80715193-80715215 TTGGAAATCAATTGAAAGGAAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130865136 15:87927022-87927044 TTGGAAATGAATAAAAAATATGG + Intronic
1130963914 15:88683258-88683280 TTGGAAATTAAAAATAAGATTGG - Intergenic
1131425747 15:92344262-92344284 TAGGAAATTAATGAAAAGGGAGG - Intergenic
1134087647 16:11369244-11369266 TTAAAAATTAAGAAAAAGGAAGG + Intronic
1134124555 16:11607562-11607584 GTAGAAAACAATAAGAAGGAAGG - Intronic
1134894748 16:17874861-17874883 TTGGAAATTAAAAATCAGAAAGG - Intergenic
1136006427 16:27333321-27333343 TTTGAAATTGACAAGCAGGATGG + Intronic
1137953889 16:52809516-52809538 ATTGAAATAAAAAAGAAGGAAGG + Intergenic
1140969826 16:80002090-80002112 TTGGAAGTTGAGAAGAAGCATGG - Intergenic
1141345277 16:83239261-83239283 TTGGAAATAAAAAAGATGAATGG + Intronic
1141389463 16:83652501-83652523 ATGGAAATTGGGAAGAAGGAGGG + Intronic
1143588247 17:7862911-7862933 TTGGAGATTTATAAGGGGGAGGG + Intronic
1143927982 17:10389840-10389862 TGGGAAATTAGAAAGTAGGAGGG - Intergenic
1144193944 17:12872780-12872802 ATGGAAATTTTTAAGAAAGAGGG - Intronic
1145403222 17:22562303-22562325 ATGGAAATTAATAATATGTAAGG + Intergenic
1146142786 17:30382977-30382999 TGGGAAAGTTATAAGAAGGCTGG - Intronic
1147051808 17:37800803-37800825 TTGGACTTTAATCAAAAGGATGG + Intergenic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147513988 17:41098555-41098577 TTGGGAAGGAATTAGAAGGAAGG + Intronic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1148853197 17:50564769-50564791 TTGGAAATTAAATTGGAGGAGGG - Intronic
1150822772 17:68449040-68449062 TTTTAAATTTATGAGAAGGAAGG - Intronic
1151032657 17:70759006-70759028 TTGCCAATTCATAACAAGGATGG + Intergenic
1151256915 17:72884673-72884695 TTAGAGTTTAATAAAAAGGAAGG + Intronic
1151335476 17:73437233-73437255 GCGGAAATGAATCAGAAGGAAGG + Intronic
1153437267 18:5080943-5080965 TTAGAAATGAATGAGAATGAAGG + Intergenic
1156517887 18:37696592-37696614 TTGGAGATTAATAAGAATCTGGG - Intergenic
1156623399 18:38880340-38880362 GAGGAAATGAAAAAGAAGGAAGG + Intergenic
1157145033 18:45153602-45153624 TTGGAAATGAATAACAAATAAGG - Intergenic
1157425930 18:47584266-47584288 GTGAAAATTATTCAGAAGGAAGG + Intergenic
1157555044 18:48607979-48608001 TTGGAAATAAATCAGGACGAAGG - Intronic
1158229128 18:55234188-55234210 TTCCAAATGAATAGGAAGGAAGG - Intronic
1158375757 18:56862836-56862858 TTGGAAATCAATTGGAAGGCAGG - Intronic
1158593740 18:58798821-58798843 TTGGAAATTAATAAGACTGCAGG + Intergenic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159318662 18:66816020-66816042 GTGGAAATAGATAAGCAGGAAGG + Intergenic
1159582997 18:70253757-70253779 TTGGAAAGTAGTAGGAAGCATGG - Intergenic
1159793058 18:72808155-72808177 CTGGCAATTAATCAGGAGGAGGG + Intronic
1159888136 18:73928972-73928994 TTAGAAATAAATAAGATAGATGG + Intergenic
1160178683 18:76616202-76616224 TTGGAAATTAGCAATGAGGAAGG - Intergenic
1164830897 19:31319906-31319928 TTGGAAAGAATTAGGAAGGAAGG - Intronic
1166907963 19:46127348-46127370 TTGCAAAGAAAGAAGAAGGAAGG + Intergenic
1166919260 19:46217648-46217670 TTAAAAATTAATAAAAAGGCCGG - Intergenic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
926346706 2:11953650-11953672 ATGGAAAGAAATAAGAAGGAAGG + Intergenic
926612517 2:14960852-14960874 TTGGCAATGGATTAGAAGGAAGG - Intergenic
926942426 2:18152446-18152468 TAGGAAAATTAAAAGAAGGAAGG - Intronic
927623317 2:24685870-24685892 TTAGAAATCAATGTGAAGGAAGG + Intronic
928925323 2:36572742-36572764 TTCCAAATTAAAAAGAAGGGGGG + Intronic
930410171 2:51015477-51015499 TTGGCAATAAAGAAGAATGATGG - Intronic
930866050 2:56122976-56122998 AGGAGAATTAATAAGAAGGAAGG + Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931086341 2:58834838-58834860 TTGGAAATTAATTAGAGGTTGGG - Intergenic
931120063 2:59206604-59206626 TTGGAAATGACAAAGAAGAATGG + Intergenic
931129819 2:59322668-59322690 TTAGAAATTAAAAAAAAGTAAGG - Intergenic
931265964 2:60660716-60660738 TTGAAAATTAAAAAAAAAGAAGG - Intergenic
931338181 2:61370877-61370899 GTGGAAATTAAAAAGTGGGAAGG - Intronic
931496436 2:62812628-62812650 TTGCAACTTCATAATAAGGATGG - Intronic
931734792 2:65184031-65184053 TTGAAAATTAAATAAAAGGAAGG + Intergenic
932009384 2:67960121-67960143 TTTGAACATAATAATAAGGATGG - Intergenic
932883026 2:75521927-75521949 TTTTAAGTTAATAAGAATGATGG + Intronic
932976451 2:76606091-76606113 TGGGAAATTAATAGGAAATATGG + Intergenic
933050165 2:77592522-77592544 TCTGAAAGTAATAAGATGGAAGG + Intronic
933062072 2:77749980-77750002 TTGTTAAATAAAAAGAAGGAAGG - Intergenic
933401834 2:81808403-81808425 TTGGAGATTATAAAGAAAGATGG + Intergenic
936636929 2:114269557-114269579 TTGTAAATTGGTAAGAGGGAAGG - Intergenic
937614694 2:123907818-123907840 TTGGAATGTAAGAGGAAGGAAGG + Intergenic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
938741823 2:134239384-134239406 TAGGAATTTAAGAAGAATGAGGG - Intronic
939006261 2:136791111-136791133 TTGGAAAGAAAGAAGAAAGAGGG + Intronic
941387915 2:164875785-164875807 TTGGAAGTTAATAATAAGGCTGG - Intergenic
941884842 2:170517266-170517288 GTGTAAATTAATAAGAAACATGG + Intronic
941992786 2:171573253-171573275 TGGGAAATTAATATGATGGATGG + Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
943997898 2:194795573-194795595 TTGGCAATAAAAAAGAGGGAAGG - Intergenic
944214812 2:197244349-197244371 TGCTAAATTAATAAGAAGGTGGG - Intronic
944879515 2:203997785-203997807 TTGGATTTTACTAAGGAGGAAGG - Intergenic
945438197 2:209844539-209844561 TTGGAAAGAAAAAGGAAGGAAGG - Intronic
946279701 2:218658173-218658195 TTAGTAATTAATAAGAATGATGG + Intronic
946683519 2:222243148-222243170 TTGGAAAATAAAAAAAAGGCAGG + Intronic
946823464 2:223653507-223653529 TTGGAAATAAAGAAGAAAAATGG - Intergenic
947053780 2:226077093-226077115 TTGGAAATTTAGAAGACAGAAGG - Intergenic
947191076 2:227505507-227505529 CTGGAAAGTAAAAAGATGGAGGG - Intronic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
948018635 2:234711708-234711730 TTTGACTTTAAAAAGAAGGAAGG + Intergenic
948441709 2:237995504-237995526 TGGGGAATTAACAAGAGGGAAGG + Intronic
1169541329 20:6603183-6603205 TTGGAAAATAAAAAGAAAGAAGG - Intergenic
1170301922 20:14893730-14893752 TTATAAATAAATAAGAAGGGTGG - Intronic
1170508921 20:17057302-17057324 CTGGACATTAATAAGGAGGTTGG + Intergenic
1170520723 20:17182052-17182074 ATGGAAATCAAAAAGAAGCAGGG + Intergenic
1170668899 20:18412016-18412038 TTGGAAATTGATCATGAGGATGG - Intronic
1171364501 20:24614592-24614614 TAGGAAAATCAAAAGAAGGAAGG + Intronic
1171854476 20:30332123-30332145 TAGGAAATAAAGAAGAGGGAGGG - Intergenic
1171890919 20:30714192-30714214 TTGGAAAATTCAAAGAAGGAAGG + Intergenic
1174310862 20:49653002-49653024 TTTGAAATGAAGAAGAATGATGG + Intronic
1175280237 20:57799345-57799367 TTGGAAATTATTCTGTAGGAGGG + Intergenic
1175693859 20:61086450-61086472 TTGTAAATTAATAAGAGGATGGG - Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1177096101 21:16835311-16835333 TTTGAAATTAATAAGTATGTTGG - Intergenic
1177192629 21:17868890-17868912 TTAGAAATTAAAAAAAAAGAAGG + Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178129809 21:29559498-29559520 TTGGAAATAAAGAAGCAAGAAGG + Intronic
1179151972 21:38816639-38816661 CAGGAAATTAATAAAATGGATGG - Intronic
1179356867 21:40667984-40668006 TTGGAAAGGTATTAGAAGGAAGG - Intronic
1179593982 21:42430135-42430157 TTGGAAACTACTGGGAAGGAAGG - Intronic
1181443612 22:22951722-22951744 TTGAAAATTAATGACAAGGAAGG + Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1181915968 22:26280188-26280210 TTGAAAAATAATAAAAAGAATGG - Intronic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182538101 22:31021130-31021152 TTGCCAATTTATAACAAGGATGG + Intergenic
1182961127 22:34476252-34476274 TTGGAAAAAAAAAAAAAGGATGG + Intergenic
949657469 3:6237467-6237489 TTGGCAATTTATAACAAGGAAGG - Intergenic
949798861 3:7881008-7881030 TTTGAAACTAATAAGAAAAAAGG + Intergenic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951365132 3:21771782-21771804 TTGAAAATAAATAACAAAGATGG + Intronic
951636416 3:24783238-24783260 TTGGATATTAGTAAGAATAATGG - Intergenic
951793139 3:26508638-26508660 TTGGAAAATAGTCAGAGGGAAGG + Intergenic
951988272 3:28645507-28645529 TTGGAAATTCTTAATAACGAAGG - Intergenic
952077076 3:29710026-29710048 ATGGAAATTAATCAAATGGAAGG + Intronic
952573497 3:34745796-34745818 TGAAAAATTAAAAAGAAGGAAGG + Intergenic
952991849 3:38837258-38837280 TTTGATATTAATAAAACGGAAGG - Intergenic
954810149 3:53242525-53242547 TTGGACTTGAGTAAGAAGGAAGG + Intronic
955011578 3:55021733-55021755 TTAGAGATGAATAAGAATGAAGG - Intronic
957017731 3:75088800-75088822 TTTGAAAATAATCAGAAAGAAGG - Intergenic
957193960 3:77043709-77043731 TGGGAAATTAATATGAACTATGG + Intronic
957599933 3:82320963-82320985 TGGGTAATTAATAAGAAAGCAGG + Intergenic
957660361 3:83143643-83143665 TTGGAAATTAATAATATGCTAGG - Intergenic
958147909 3:89650444-89650466 TTAAAAAATAATAAGATGGAGGG + Intergenic
958506993 3:94992604-94992626 TGGGAAATTAATATACAGGAGGG + Intergenic
959515120 3:107257328-107257350 TTTGAAATATATCAGAAGGAAGG + Intergenic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959646370 3:108707823-108707845 TTGGAAATTATGCAGAAAGATGG - Intergenic
959704399 3:109326251-109326273 TTCCAAATTAATAGAAAGGAAGG + Exonic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960098836 3:113716327-113716349 TAGGAAAGTGATAAGAATGAAGG + Intergenic
960170845 3:114459220-114459242 GAGGAAGTTTATAAGAAGGAAGG - Intronic
960329008 3:116334332-116334354 TTGGAAATGTTTGAGAAGGACGG - Intronic
961119449 3:124361218-124361240 TTAGAAAAAAATCAGAAGGAAGG - Intronic
963399543 3:144780223-144780245 TTGAAAATTTTTAAGAAAGAAGG - Intergenic
963609979 3:147454501-147454523 TTGGAAATTAAGAAGAATAAGGG + Intronic
963652796 3:148004671-148004693 TTGGAAATTTAAAAAAAGAAAGG + Intergenic
963759716 3:149274980-149275002 TTGGAAAAAAAAAAAAAGGAAGG - Intergenic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
963989095 3:151632691-151632713 TTGGATATTAAATAGAAGGTTGG + Intergenic
964371574 3:156005443-156005465 TAGCAAATAAATAACAAGGAAGG - Intergenic
964380073 3:156089420-156089442 TTGGAAGTTAAAAAAAAAGATGG + Intronic
965800221 3:172484803-172484825 TGCCAAATTAATTAGAAGGATGG + Intergenic
966780539 3:183580314-183580336 TGGGAAATTAATAAGCTGTATGG + Intergenic
967215654 3:187207834-187207856 TTGCAAATTTATAACAAAGATGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967648805 3:191960322-191960344 ATGGAAATTACAAAGAACGAAGG - Intergenic
967701103 3:192593127-192593149 TTGGATTTTATTAAGAATGAAGG - Intronic
969947878 4:10803007-10803029 TTGGAAATTTATAACAAACACGG + Intergenic
970305347 4:14725947-14725969 TTGGTGATTAAGAAGAATGAGGG - Intergenic
970604881 4:17670078-17670100 TTAGAAAGCAATAAGAAGGTAGG + Intronic
970838382 4:20438135-20438157 TTGGAGAATCATAAGAAGGGAGG - Intronic
971223448 4:24730323-24730345 TTGGAAATTAAAAAAAAAAAAGG + Intergenic
971897291 4:32614284-32614306 TTGGAAACTGATAAGAGGGAGGG - Intergenic
972057453 4:34821692-34821714 TTCAAAATTTATAAAAAGGAAGG - Intergenic
972462790 4:39321038-39321060 TTGGAAATTAACAAGAAGCCAGG + Intronic
972827924 4:42783005-42783027 TTTGAAATAAATAAGATAGACGG - Intergenic
973128570 4:46620479-46620501 TTGGAAATTCATAGGAAAAATGG + Intergenic
973639531 4:52888979-52889001 TTAGAAATTCAAGAGAAGGAAGG - Intronic
973938430 4:55876809-55876831 ATGGAAATTAAAAAGAAAAAAGG - Intronic
974001511 4:56515999-56516021 GTAGAAATTAATAAGAAGGATGG + Intronic
974078932 4:57193460-57193482 TTGGAAAATAATAAGACAGTTGG + Intergenic
974180990 4:58384779-58384801 ATGGAAAGTAAAAAGAAGCAGGG - Intergenic
974428824 4:61770598-61770620 TTGGGGATTGTTAAGAAGGATGG + Intronic
975071923 4:70151779-70151801 TTGGAAATTATGATGAAGAAAGG - Intronic
975892703 4:79048670-79048692 TTGGGAACTAGGAAGAAGGAAGG + Intergenic
976104517 4:81602513-81602535 GTGGAAACTTATAAGAAAGAGGG - Intronic
977051300 4:92131199-92131221 TTGACAAATAATAAGAAGAAAGG + Intergenic
978642596 4:110889246-110889268 TTGGAAATTAAAGACAAGGATGG + Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980553286 4:134368697-134368719 TGGGAATTTAATAATAAGGAAGG - Intergenic
980727322 4:136780345-136780367 CTGGATTTTAAAAAGAAGGAGGG - Intergenic
981197108 4:141934441-141934463 ATGGAAATTACTAAAATGGAAGG - Intergenic
981471497 4:145140545-145140567 TTGGAAACTAAAAAGGAGGGAGG + Intronic
981734036 4:147930645-147930667 TTGGAAATAAATGAGAAGATAGG - Intronic
982191500 4:152860699-152860721 TTGGAAATAAATTAAACGGAGGG - Intronic
982302137 4:153890902-153890924 ATGGAAAGTAATAAGAAAGGGGG + Intergenic
982908981 4:161116066-161116088 ATGGAAATTAAAAAAAAGCAGGG - Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983337265 4:166413494-166413516 TTTAAAATTTATAACAAGGAAGG - Intergenic
983378507 4:166960420-166960442 TTGGAATTTACTCTGAAGGATGG + Intronic
983442022 4:167798385-167798407 CTAGAAATTCATAGGAAGGAAGG + Intergenic
983611098 4:169646146-169646168 TTAGACATTTGTAAGAAGGAAGG - Intronic
983997359 4:174200002-174200024 TTTAAAATAAATAAGAAGAAAGG - Intergenic
984279359 4:177650318-177650340 TAGGAAATGACTAAGAAGTAAGG - Intergenic
984463354 4:180063773-180063795 TTGGAAAATAATAATTAGAAAGG - Intergenic
984765365 4:183396741-183396763 TTGTAAATAACTAAGAAGGTGGG - Intergenic
985419318 4:189767863-189767885 TGAGAAATTTATAAGGAGGAAGG + Intergenic
985421891 4:189792760-189792782 TTGGGACTTGATAAGAAGGAAGG - Intergenic
986612937 5:9588194-9588216 TTGCACACAAATAAGAAGGAAGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987368272 5:17169864-17169886 TTGTAAATTAACAGGAAAGAGGG - Intronic
988357266 5:30194186-30194208 TTGAATATTAATAAGAAGAATGG - Intergenic
988692618 5:33588014-33588036 TTGGAAATCAGTAAGCTGGAAGG - Intronic
988715936 5:33828372-33828394 CTGGAAATAAATAAGAAGATGGG - Intronic
989458990 5:41674694-41674716 TAAAAAATTAAAAAGAAGGAAGG - Intergenic
990128341 5:52547947-52547969 TTGGAATTTACTAAGAAAGCAGG - Intergenic
990270831 5:54137127-54137149 TTGCACATTAAAAACAAGGATGG + Intronic
990813120 5:59751211-59751233 TTGCAATTCAGTAAGAAGGAAGG + Intronic
991547089 5:67794791-67794813 TTGCTACTTAATAACAAGGATGG - Intergenic
991670554 5:69043215-69043237 TTGGATAGGAATAAGACGGAAGG - Intergenic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
993162063 5:84304885-84304907 TTGGAAATATATAAAAAGCAAGG + Intronic
994182169 5:96779503-96779525 TTGGAAATGAAAAAGAATGAAGG - Intronic
994249615 5:97520586-97520608 TTGTAAAGTAATAAGTAGGGAGG - Intergenic
994251678 5:97543175-97543197 TTTGAAATAAAAAGGAAGGAGGG + Intergenic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
995219924 5:109636587-109636609 TTTGAAACTAATGAGAACGAAGG + Intergenic
995330977 5:110945663-110945685 TGGGAAAGTAATAGGAAAGATGG + Intergenic
995572039 5:113490776-113490798 TTGCCAATTTATAACAAGGATGG - Intergenic
995834696 5:116388365-116388387 TAAGAAATTAATAAAATGGAGGG + Intronic
996445645 5:123546563-123546585 TTGCAAAAAACTAAGAAGGAGGG + Intronic
996741166 5:126800381-126800403 TTGGAAACTAAGACCAAGGATGG - Intronic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998589852 5:143465320-143465342 TTGCTAATTTATAACAAGGATGG + Intergenic
998965080 5:147530535-147530557 TTGGAATTTAGTAAGATGAAGGG + Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999775525 5:154810000-154810022 TTAGAAATTAATAGTAAGGCAGG - Intronic
1000204261 5:159042730-159042752 TAAGATATTAATAAGTAGGAGGG - Intronic
1000808421 5:165827505-165827527 TTGGAAATTAAGAATAGGAAAGG - Intergenic
1001992127 5:176126212-176126234 TTGGAACTAAAGAAGAAGAATGG + Intronic
1003500729 6:6700793-6700815 ATGGCAATTACAAAGAAGGAGGG + Intergenic
1003759941 6:9168005-9168027 CTTGAAAGTAATAAGAAGAAAGG - Intergenic
1004363049 6:14987890-14987912 TTGGAGGTTAGTAACAAGGAGGG + Intergenic
1005736424 6:28751933-28751955 TTAGAAATAAATGAGAAAGAAGG + Intergenic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1007215380 6:40233491-40233513 TTGGAAATAGATAAAAATGATGG - Intergenic
1007911204 6:45516037-45516059 TTGAAAATTACTCAGAAGAAAGG - Intronic
1008084086 6:47225626-47225648 TTTAAAATTAATAAGAAAGAAGG + Intergenic
1008278708 6:49570763-49570785 TTGGCAATTACTCAGAAGCAGGG + Intergenic
1008971134 6:57369578-57369600 TTGGACATTAATCAGAGTGAAGG + Intronic
1009312059 6:62167408-62167430 TTGGGCATTAATTAAAAGGATGG + Intronic
1009358319 6:62780809-62780831 GTGGAATTTTATTAGAAGGAAGG + Intergenic
1009767017 6:68091158-68091180 TTGGAAATTTGTATGAAAGAAGG - Intergenic
1010218726 6:73428801-73428823 TTTGAAATTAAGAAGAAACATGG - Exonic
1010641409 6:78332639-78332661 TTGGAAAGTAATAAGTACTAAGG - Intergenic
1010820425 6:80409073-80409095 TTTGAAACCAATAAGAAGAAAGG - Intergenic
1010863752 6:80946766-80946788 TTTAAAATTAATATGAAAGATGG - Intergenic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1011384587 6:86781591-86781613 ATGGAAGTTAGGAAGAAGGATGG - Intergenic
1011798178 6:90980541-90980563 TTGGCAAGGACTAAGAAGGAAGG + Intergenic
1012419432 6:99047324-99047346 TTGGAAATTAATCCCTAGGATGG + Intergenic
1012567164 6:100672170-100672192 TTTGAAATAAATAATAAAGAGGG - Intronic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012797703 6:103784130-103784152 TTGGAAATTTATATCAAAGATGG + Intergenic
1012913218 6:105139845-105139867 TTGAAAGTTAATATGAAGCAAGG + Intergenic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013635469 6:112025279-112025301 AGGGAAATAAATAAGAATGAAGG - Intergenic
1014464589 6:121740002-121740024 TTGACAAATAATAAGAAAGATGG - Intergenic
1014607286 6:123492720-123492742 TTGGAAATTGATAGTACGGATGG - Intronic
1014860012 6:126454512-126454534 TTTGAAATTAATGAGAACAAAGG + Intergenic
1015204074 6:130615401-130615423 TTGGGAACTGACAAGAAGGAGGG + Intergenic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1015943298 6:138473988-138474010 GTGGAATTTAATAGGAAGGCAGG + Intronic
1016549777 6:145266245-145266267 TTGGAACTAAATTAAAAGGAAGG + Intergenic
1017267793 6:152470852-152470874 TTGAAAATTAATTTGTAGGATGG + Intronic
1017399490 6:154043172-154043194 TTGGAAATTTACTGGAAGGATGG - Intronic
1017476369 6:154798190-154798212 TTTAAAATTAATAAGAATCATGG + Intronic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1020362395 7:7341569-7341591 CTGAAAATTAATAAGAAGTCAGG - Intergenic
1020513255 7:9085897-9085919 GGGGATATTAATAATAAGGAAGG + Intergenic
1020783267 7:12542065-12542087 TTGAAAATTAATAAAAGGGGAGG + Intergenic
1020861637 7:13500103-13500125 TTGGAAATTGCTACAAAGGAGGG - Intergenic
1021837056 7:24688072-24688094 TAAGAAATTTATAAGAAGGAAGG - Exonic
1022222571 7:28328247-28328269 TTGGATTTTACTAAGAAGGGAGG - Intronic
1022637719 7:32153011-32153033 TTGGAAAATATTAAGAAAGGAGG + Intronic
1022655445 7:32315360-32315382 TTGCAAATTGAAAGGAAGGAAGG + Intergenic
1023008621 7:35904258-35904280 TTGGAAAAGAACAAGAAGAAAGG + Exonic
1023016550 7:35973629-35973651 TTGGAAAAGAACAAGAAGAAAGG + Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1024212047 7:47214504-47214526 TTGGAGATTAGCAAGATGGATGG - Intergenic
1024529360 7:50378391-50378413 GTGGAAATTAACATGAAGGTAGG + Intronic
1025016455 7:55442818-55442840 TTGGAAAATAAAAAGCAGGCCGG + Intronic
1025313643 7:57987276-57987298 TTCGAAATTAATCAAAAGAAAGG + Intergenic
1026533111 7:71217577-71217599 TTAAAAATAAATAAAAAGGAGGG - Intronic
1028215347 7:88125491-88125513 TATAAAATTCATAAGAAGGAAGG + Intronic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1030352091 7:108501004-108501026 TTTGACATCAATATGAAGGAAGG - Intronic
1030436672 7:109530426-109530448 TTGCCAATTTATAACAAGGATGG + Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1033999667 7:147397658-147397680 TGGTAAATTAATAAAATGGAAGG + Intronic
1034055454 7:148030333-148030355 TTGGAATTTAATTAAAAGAAAGG + Intronic
1034611006 7:152368626-152368648 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1034736690 7:153435367-153435389 TTGGAAATAATTAATAAGGAAGG + Intergenic
1036402277 8:8419996-8420018 TTGGAACATAGTAAGAAAGAAGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1039126050 8:34203195-34203217 TTGGAAATCAAGAAGAAACATGG + Intergenic
1039131347 8:34267819-34267841 TCGGAGCTTAAGAAGAAGGAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040746318 8:50646635-50646657 TTGGAAGACAATAGGAAGGAGGG - Intronic
1041442008 8:57907311-57907333 ATGGAAATTAAGAGGAAGAAAGG + Intergenic
1041607531 8:59800413-59800435 TAGGAATCTAATAAGAGGGATGG - Intergenic
1042275449 8:67000138-67000160 TTCAAAATTAATTTGAAGGAAGG - Intronic
1042624610 8:70743995-70744017 TTATAGATTAATAAGAAGGTGGG - Intronic
1042817149 8:72890073-72890095 TTGGAAAGAAAAAAGAAGGATGG + Intronic
1043052995 8:75405391-75405413 TTGGACAACAATAAGAAGAAAGG - Intergenic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043779560 8:84313983-84314005 TGGGTAATTTATAAGAAAGAGGG + Intronic
1044372740 8:91432508-91432530 TTAGATATTTTTAAGAAGGATGG - Intergenic
1044549911 8:93500508-93500530 TTGTAGATTAAAAAGAAAGAAGG + Intergenic
1044711367 8:95061482-95061504 TTGGAAATGGGTCAGAAGGAGGG + Intronic
1044781742 8:95750529-95750551 TTGAACATTAACAGGAAGGATGG - Intergenic
1045522961 8:102919366-102919388 TTAGAAACAAATCAGAAGGAAGG - Intronic
1045995274 8:108354717-108354739 TTAGACATTAATATCAAGGAAGG - Intronic
1046050889 8:109021239-109021261 GTGTAAAATAATAGGAAGGATGG - Intergenic
1046082265 8:109384892-109384914 TTGTAACTTAATAAGAAAAATGG - Intronic
1046426932 8:114065963-114065985 TTAAAAAATAATAAAAAGGATGG - Intergenic
1048273623 8:133048978-133049000 TTGGAAATGGAAAAGAAAGAAGG - Intronic
1048294007 8:133200940-133200962 GTGGAAATTGATGAGAGGGAGGG - Intronic
1049860066 8:144892275-144892297 TTGAGAATTCATAAGAAGAATGG + Intronic
1049871752 8:144984562-144984584 TTGGAAATTAAAAAGCATGGTGG + Intergenic
1051024089 9:12585463-12585485 TTGAAACTTGACAAGAAGGAAGG - Intergenic
1052273176 9:26648977-26648999 TTAGAATTTAAAAAGAAGGTAGG - Intergenic
1053571381 9:39312199-39312221 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1053837214 9:42152478-42152500 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054092943 9:60870897-60870919 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054114419 9:61146809-61146831 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054125764 9:61306813-61306835 TTGGAAGTAAAAGAGAAGGAAGG + Intergenic
1054593335 9:67035712-67035734 TTGGAAGTAAAAGAGAAGGAAGG + Intergenic
1055019027 9:71649243-71649265 TTGGAAATTAGGAAGAAGGTAGG + Intergenic
1055489114 9:76786690-76786712 TTGGAAATTAATAAAAATAAGGG - Intronic
1056608109 9:88104114-88104136 ATGGAAACTGATGAGAAGGATGG + Intergenic
1057856859 9:98608099-98608121 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1058193103 9:101942167-101942189 TTTAAAATTGAAAAGAAGGAAGG + Intergenic
1058388020 9:104461407-104461429 TTGGAAATAAAAAAGAACTATGG - Intergenic
1058549453 9:106098311-106098333 TTGGAAATTCACAAGAATGAAGG - Intergenic
1058936121 9:109771308-109771330 TTGGAAAGTTAGAAGAAGGAGGG + Intronic
1059497078 9:114718815-114718837 TTGGAAATTTATTAGAAGGCAGG - Intergenic
1059542567 9:115144556-115144578 TGGGAATTTAAAAAGAAAGAAGG - Intronic
1059873493 9:118604438-118604460 TTGGAAATTGTTGAGGAGGAGGG + Intergenic
1060015638 9:120084112-120084134 TAGAAAATAAATAAGAAGGAAGG + Intergenic
1186143038 X:6597157-6597179 ATGGAAATTAACAGGGAGGATGG + Intergenic
1186365658 X:8890646-8890668 ATGGAAATTCATACCAAGGAAGG - Intergenic
1187291346 X:17956637-17956659 TTGGATATTGATAATAAGGGTGG - Intergenic
1187334670 X:18371869-18371891 TTGCAACTTTATAACAAGGATGG - Intergenic
1187739599 X:22341330-22341352 TTGGAATTAGATAAGAAGGGAGG + Intergenic
1188671574 X:32887966-32887988 TTGGATATTAATCAGAGTGAAGG - Intronic
1189891061 X:45603138-45603160 TTGGCAATTAATAACAGGCAAGG - Intergenic
1190836059 X:54101714-54101736 TTGCCAATTTATAACAAGGATGG + Intronic
1191132730 X:57031463-57031485 TTAGAAATTAATAGTTAGGAGGG - Intergenic
1191225462 X:58038227-58038249 TTGCCAATTTATGAGAAGGATGG - Intergenic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1193347106 X:80416492-80416514 TTTGAAATTAGTAAGAAAAAAGG - Intronic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1194154383 X:90369022-90369044 GTCCAAATTAATATGAAGGAGGG + Intergenic
1195280547 X:103328740-103328762 TTGCATATTAGTAAGAAGAATGG - Intergenic
1195389280 X:104344322-104344344 TTGGAACATAAAAAGAAGGCAGG - Intergenic
1196366370 X:114928708-114928730 CTGAAAATTAATAAGAAAAAAGG - Intergenic
1197902747 X:131391763-131391785 TTGGAAAATATGGAGAAGGAAGG - Intronic
1197982629 X:132233578-132233600 TTCCAAATTAAAAAGGAGGAAGG - Intergenic
1198392471 X:136190110-136190132 TTGGAAATGAGCAAGAAGGGTGG + Intronic
1198701613 X:139402769-139402791 TTGGAAACTTCTAAGAAGGAGGG + Intergenic
1198797409 X:140413600-140413622 GTGGAAATTAATAAAATAGAAGG + Intergenic
1199375531 X:147103647-147103669 TTTGAGATAAATAAAAAGGAGGG + Intergenic
1199636170 X:149813798-149813820 TTGAAAATTAAAAAGAAAGCTGG - Intergenic
1199888573 X:152049823-152049845 TTGTCAATTTATAAGCAGGATGG + Intergenic
1199924735 X:152450648-152450670 CTGGAAATAAGAAAGAAGGAGGG - Intronic
1200500740 Y:3945919-3945941 GTCCAAATTAATATGAAGGAGGG + Intergenic
1201893561 Y:18969874-18969896 TTGCAAATTAATATCAAAGAAGG + Intergenic
1202018669 Y:20440361-20440383 GTGGATATTAATAAAAAGTAAGG + Intergenic
1202131762 Y:21618620-21618642 TGGCATATTAATAAGAAAGAGGG + Intergenic