ID: 1043060345

View in Genome Browser
Species Human (GRCh38)
Location 8:75492531-75492553
Sequence GTGGTGAAGGCCATCATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043060345 Original CRISPR GTGGTGAAGGCCATCATTAT TGG (reversed) Intronic
900898624 1:5501925-5501947 GTGGTGCAGGCCGTCGTGATGGG - Intergenic
912262866 1:108126589-108126611 GAGGAGAAGGCCATCAGTAAAGG + Intergenic
916888158 1:169090570-169090592 GTGCTAAATGCCATCATTGTGGG + Intergenic
924124831 1:240839653-240839675 GAGGTGAAGGGCAGCATTCTTGG + Intronic
1065428341 10:25628786-25628808 GAGGTGGAGGCCATCATCCTCGG - Intergenic
1069651225 10:70051286-70051308 ATGGGAAAGGACATCATTATGGG + Intergenic
1077021977 11:420987-421009 GTGCAGATGGCCATCATCATGGG - Exonic
1080054110 11:27887425-27887447 GTGGTGTAGATCATCATTGTTGG + Intergenic
1083092825 11:60218612-60218634 GAGGAGAAGGCCATCACTATCGG - Intronic
1086236325 11:84635318-84635340 GTGGTAATGGGCATCAGTATTGG - Intronic
1095973114 12:47918524-47918546 GTGGTCAAGGTGAACATTATTGG + Intronic
1106313302 13:28572467-28572489 GAGGTGAAGGGCATTGTTATAGG - Intergenic
1106676987 13:31971000-31971022 GTGGTGAAGCCCATGAGTCTGGG - Intergenic
1109117768 13:58410238-58410260 CTGGTGAAGGCCCTCTTCATAGG - Intergenic
1113241973 13:108348038-108348060 GTGCTCAAGGCCAACATTAAGGG - Intergenic
1114694767 14:24616378-24616400 ATGGTGAAGGCCATGCTTAGAGG + Intergenic
1114972310 14:28048141-28048163 GAGCTGAAGGCCATGATTCTAGG - Intergenic
1122396118 14:101433263-101433285 GTGATGAAGGTCAACATTAATGG + Intergenic
1125489234 15:40134488-40134510 TTGGTGAAGGCAATAATAATTGG + Intergenic
1127300708 15:57650970-57650992 GTGATGAAGGACATCCTTCTTGG - Intronic
1131073457 15:89480165-89480187 TGGGTGAAGGCCACCATGATGGG - Intronic
1135594002 16:23727640-23727662 GTGGTGGCGGCCATCTGTATCGG - Intergenic
1136990532 16:35148838-35148860 GTGCTCAGGGCCATCATCATGGG - Intergenic
1141479361 16:84296057-84296079 GTGGAGGAGGCTATCATTTTTGG + Intronic
1147496709 17:40923306-40923328 GAGGTGAAGACCTTCATCATAGG + Intronic
1148981974 17:51584557-51584579 GTGGTGAAGGACACAATCATTGG - Intergenic
1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG + Intronic
1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG + Intronic
1157952747 18:52057939-52057961 GTGGGGGAGCCCATCATTACTGG + Intergenic
1159105127 18:63995991-63996013 GTTGCGTAGGCCATCATGATGGG + Intronic
1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG + Intergenic
925517543 2:4700268-4700290 GTGGTGAAGTCTAGCATTAGTGG - Intergenic
927169302 2:20355013-20355035 TTGGTGAACACCATTATTATAGG + Intergenic
927457770 2:23271870-23271892 GTGGTGAAGTCCTGCTTTATGGG + Intergenic
929898037 2:45978443-45978465 TAGGTGAAGGCCAACATTAGAGG - Intronic
934853752 2:97716723-97716745 GTGGTGATGGGCATCATGAAGGG + Intronic
937589880 2:123600107-123600129 GTGGTCAGGGCCCTCATGATTGG + Intergenic
944365807 2:198918179-198918201 GTAGTGATTGCCATCATTAATGG + Intergenic
945028312 2:205640379-205640401 GTAGAGAAGGCCATCAATAAGGG - Intergenic
1174855993 20:54046186-54046208 GTGGTTAAGTCAATCATTTTGGG - Intronic
1182847249 22:33441716-33441738 GTGGTGCATGCCAGCACTATGGG - Intronic
1184097472 22:42324232-42324254 ATGGTGGTGGCCATTATTATTGG + Intronic
951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG + Intronic
954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG + Intronic
955955808 3:64288258-64288280 GTCATCAATGCCATCATTATAGG - Intronic
962390673 3:134969535-134969557 GTGATGAAGGCCTTCATTTAAGG + Intronic
964904068 3:161696218-161696240 GAGGGTAAGGCCATCATGATGGG + Intergenic
965608861 3:170524095-170524117 GTGGTGAAGGCCTCAATTACTGG + Intronic
968604752 4:1529361-1529383 GTGCTGAAGGCCAGCATTTGCGG - Intergenic
970255720 4:14167825-14167847 GTTGTGAAGGAAATCATTAAAGG - Intergenic
972584891 4:40428769-40428791 GTGGTGAATGCTATCATAAAAGG - Intronic
975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG + Intergenic
977343403 4:95788889-95788911 GCTGTGAAGGCCATTATTATTGG - Intergenic
981923849 4:150116787-150116809 GTGATGAAGGCCATGGTGATAGG + Intronic
993793415 5:92235815-92235837 GTGGTGAAGGCCCCCAATACAGG - Intergenic
997007414 5:129834420-129834442 GTGGGAAAGGCCGTCATTAGTGG - Intergenic
1001748927 5:174112959-174112981 GAGCTGGAGGCCATCATTCTCGG - Intronic
1003135073 6:3428700-3428722 GTTGTGAAGGGCTTCCTTATTGG - Intronic
1005805388 6:29469704-29469726 GTGGTGAGAGCCAACATTCTTGG - Intergenic
1017729480 6:157302338-157302360 CTGGTGAAAGGAATCATTATAGG - Intronic
1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1037107656 8:15129064-15129086 GTGGTGAAAGGGATGATTATAGG - Intronic
1039274064 8:35915522-35915544 TTCTTAAAGGCCATCATTATTGG + Intergenic
1042873589 8:73419934-73419956 GTGGGGAAGTCCGTCAGTATTGG - Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043761038 8:84068634-84068656 GAGCTGGAGGCCATCATCATAGG - Intergenic
1049680176 8:143914692-143914714 GTGGTGGAGGCCCTCATACTAGG + Intergenic
1051474501 9:17490177-17490199 ATGCTGAAGGCCAACATTGTAGG + Intronic
1053086261 9:35225676-35225698 GTGGTGTAGGCTATAATTGTTGG + Intronic
1059323327 9:113486171-113486193 GTAATAAAGGCCATCAGTATGGG + Intronic
1061650274 9:132042215-132042237 ATGGTGACGGCCATCACTACCGG + Intronic
1189077936 X:37937618-37937640 GTTGTGTAGGCCATAATTCTGGG - Intronic
1191888281 X:65912639-65912661 GAGCTGAAGGCCATTATTATTGG - Intergenic
1192194538 X:69019432-69019454 GTGGTGAAGGACATGATAACTGG - Intergenic
1197306943 X:124854083-124854105 GGAGTGAAGGCAATGATTATTGG + Intronic