ID: 1043064314

View in Genome Browser
Species Human (GRCh38)
Location 8:75547601-75547623
Sequence GTGTTGTTGACAAGGACAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043064314 Original CRISPR GTGTTGTTGACAAGGACAAA AGG Exonic
908450193 1:64247019-64247041 GTGTTGTTTCCAAAGACAAGTGG - Intronic
918043185 1:180925713-180925735 GACTGGTTCACAAGGACAAAGGG - Intronic
919034247 1:192285133-192285155 ACGTGGTAGACAAGGACAAAGGG - Intergenic
919328694 1:196140890-196140912 GTACTGTTGACAAAGAAAAATGG + Intergenic
919597686 1:199583978-199584000 GTGAGGTTAACAAGGACAACTGG + Intergenic
920320641 1:205119552-205119574 GTGTGGGAGACAAGGGCAAAAGG - Intronic
921515021 1:216080020-216080042 TTGTTGTTGACAAGGAGGAGGGG + Intronic
921539696 1:216398693-216398715 GTGGTGTTGACAGGGCCAAGAGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921826256 1:219675122-219675144 CTGATATTGACAAGAACAAATGG - Intergenic
923812777 1:237338172-237338194 ATGTTATTGACAAGATCAAATGG + Intronic
923831874 1:237567152-237567174 GTGTTGTTTATAATCACAAACGG + Intronic
923922880 1:238588707-238588729 GTGTTGGTAACAAGGAGAAAAGG - Intergenic
1064528183 10:16280077-16280099 GTGTTGATAACAAGAGCAAAAGG - Intergenic
1065523557 10:26594874-26594896 GTGTTTTTCACATGGACACAAGG - Intergenic
1067961547 10:50857736-50857758 TTGTTGTTGGCAAGGAGAAGTGG + Intronic
1070220313 10:74435645-74435667 GACTATTTGACAAGGACAAAAGG + Intronic
1070766901 10:79061967-79061989 GTGCTGTTTTCAAGGACACACGG - Intergenic
1074793231 10:116913761-116913783 GGGTTGTTGTCAAGATCAAATGG - Intronic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078831116 11:14978056-14978078 CTTTTGTTGACAAGGAGACAAGG - Intronic
1079767932 11:24417272-24417294 GTTTTATAGTCAAGGACAAAGGG + Intergenic
1085955400 11:81387134-81387156 GAGATGTTGAAAAGAACAAAGGG - Intergenic
1086391595 11:86370555-86370577 GTGTTGTTGTAAAGGACTACCGG - Intergenic
1086572025 11:88296056-88296078 CTGTTGTTGGCAAAGGCAAAAGG - Intronic
1088010373 11:104993905-104993927 CTGTTGGTGACAATGTCAAATGG - Intergenic
1090843602 11:130513445-130513467 GTGTTGTTTGCAGGGACATATGG + Intergenic
1091130851 11:133146192-133146214 GTCTTCTTGATAAGGACACAGGG + Intronic
1092769278 12:11882081-11882103 GTGTTTTGGAAAAGGACAAGTGG - Intronic
1095572984 12:43703750-43703772 GTCCTGTTGACAAAGAAAAATGG - Intergenic
1097120191 12:56725438-56725460 GGGGTGGTGACAAGGACTAAAGG + Intronic
1097501137 12:60404099-60404121 GTATTGGTGTCAAGGACACAAGG + Intergenic
1097569168 12:61309886-61309908 TTGTTGCTGACAAGATCAAATGG - Intergenic
1099133814 12:78867118-78867140 CTTTTGGTTACAAGGACAAAGGG + Intronic
1099456517 12:82869514-82869536 GTGTTGTGGAGATGGACAAATGG - Intronic
1101383304 12:104233371-104233393 GTCCTGTTGACAAAGAAAAATGG + Intronic
1102714975 12:114962512-114962534 GAGTTGTCGACAAGTACCAAAGG - Intergenic
1103198163 12:119064315-119064337 GTGCTGTTGCCAATGCCAAAAGG + Intronic
1104468464 12:129008821-129008843 GTGTTACTGACATGGCCAAATGG - Intergenic
1107052474 13:36066343-36066365 GTGTTGTGGCCAAGGACCAATGG - Intronic
1108110402 13:47065416-47065438 GTGTTGTGGAAAGGGAGAAATGG + Intergenic
1108607172 13:52051336-52051358 GTGTTATTGAAAATGGCAAAAGG - Intronic
1109403409 13:61865184-61865206 CTGCAGTGGACAAGGACAAAAGG + Intergenic
1110049759 13:70881464-70881486 GTTTTGTTGAGAAGGCAAAATGG + Intergenic
1110278457 13:73664381-73664403 ATGTTGTGGAGAAGGACACATGG - Intergenic
1110523777 13:76511908-76511930 CTGGTGTTGACAAAGAGAAAAGG - Intergenic
1110952929 13:81518073-81518095 GTTCTGTTGACAAAGAAAAATGG + Intergenic
1111422527 13:88033132-88033154 GTGATGAGGGCAAGGACAAATGG - Intergenic
1112914791 13:104535064-104535086 GTGTTTTTGAAAAACACAAAGGG + Intergenic
1113215048 13:108030324-108030346 AGGTTGTTGACATGGTCAAAAGG + Intergenic
1113336146 13:109378047-109378069 ATTTTGTAGACAAGGACATAAGG + Intergenic
1113379767 13:109792701-109792723 GTGTTTTGAACAAGGAAAAATGG - Intergenic
1114837639 14:26222428-26222450 GTGTTGTTTTCAAGTAGAAATGG - Intergenic
1116091299 14:40310151-40310173 AGGTGGGTGACAAGGACAAAGGG + Intergenic
1120519620 14:85511372-85511394 TTGTAGTTGACAAGGAGAAGGGG - Intergenic
1125442641 15:39719476-39719498 GTGGTGTTGACTAGGCCAAAAGG + Intronic
1130126562 15:81098923-81098945 GGGGTGTTGACAAGGAGGAAAGG + Intronic
1130154011 15:81334082-81334104 GGGGTCTTGACAAGGAGAAAGGG - Intronic
1131613657 15:93990788-93990810 GTAAGGTTGACAAGGACACATGG - Intergenic
1133824859 16:9269005-9269027 GTTTTGTTGATAAGAAGAAAGGG - Intergenic
1135129713 16:19843010-19843032 GCTTTGTTGACAAGGAGAATAGG + Intronic
1139224296 16:65218983-65219005 TTGTTGTTGAGGAGGACAACTGG + Intergenic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1144593422 17:16544559-16544581 GTCCTGTTGACAAAGAAAAATGG - Intergenic
1146240126 17:31213586-31213608 GTGTTCTTTTCAAGGAAAAAAGG + Intronic
1146575782 17:33989949-33989971 GTGATATTGACAAGGACAGCTGG + Intronic
1146600198 17:34207602-34207624 TTGTTGTTGAGAAGGTAAAATGG - Intergenic
1148543781 17:48501520-48501542 GTGACATGGACAAGGACAAATGG - Intergenic
1149004750 17:51793946-51793968 GTGTTGTGTACAAAGAGAAAAGG - Intronic
1149903589 17:60504964-60504986 GGGTTGTTATCAAGGAAAAATGG + Intronic
1150821181 17:68435713-68435735 CTGTTGGTGAAAAGGAAAAATGG + Intronic
1153673673 18:7436592-7436614 GTGTGGTTGAGCAGGACAAGGGG - Intergenic
1153904057 18:9645134-9645156 GTGTTCTTGACCTTGACAAAAGG - Intergenic
1160467144 18:79088771-79088793 GTGATGTTGAAAAAGACCAAAGG - Intronic
1162380787 19:10330464-10330486 GTTTTGTGGACAAATACAAAGGG - Exonic
1167304693 19:48700951-48700973 GTGGTGTTACCAAGGAGAAAAGG + Intronic
1167898745 19:52602214-52602236 GTGCTGGTGGCAAGGACAGAGGG + Intronic
1168548454 19:57273241-57273263 GTGTTGCAGACAAGAACACAGGG - Intergenic
925156246 2:1650846-1650868 GTGATCTTGACAAGCAGAAATGG - Intronic
925857722 2:8146383-8146405 GTGTTGCTGAAAAGGACGAGAGG - Intergenic
926040378 2:9667991-9668013 CTGTTGTTGACACCAACAAATGG + Intergenic
927577156 2:24209313-24209335 GCCTTGTTGAGAAGGAGAAAGGG + Intronic
930058562 2:47270592-47270614 GTGTTCTTGATAGGGAAAAAGGG + Intergenic
930119066 2:47745127-47745149 GTGGTATTGAAAATGACAAAAGG - Intronic
930679320 2:54239605-54239627 GTGTTTCTAACAAGGACATATGG - Intronic
930874608 2:56200646-56200668 GTGTTTTTGAAAAGGGAAAATGG + Intronic
931144625 2:59503739-59503761 TTTTTATAGACAAGGACAAAGGG + Intergenic
934920029 2:98335573-98335595 GTGTGGATGACTTGGACAAAAGG + Intronic
935659787 2:105456307-105456329 GTGTTGTTGGCACACACAAAAGG + Intergenic
935941215 2:108241262-108241284 GTCCTGTTGACAAAGAAAAATGG + Intergenic
936664802 2:114581882-114581904 ATGTTGTTAACAAGGAAAACTGG - Intronic
937617549 2:123943982-123944004 TTGTAGATGACAAAGACAAATGG - Intergenic
939407239 2:141774231-141774253 GGGTAATTTACAAGGACAAAAGG + Intronic
940184488 2:150968414-150968436 TTGTTGTTTACAAAGACGAATGG + Intergenic
943892990 2:193315169-193315191 ATGTTCTTGACTAAGACAAAAGG - Intergenic
944174640 2:196816371-196816393 ATGCTGCTGAAAAGGACAAATGG - Intergenic
947047089 2:225999930-225999952 GTGTTGATGCAAAGGACAATAGG - Intergenic
947660208 2:231860882-231860904 GTTTTCTTGACAAGAACGAAGGG - Intergenic
947874494 2:233459339-233459361 TTGTTGTTGAAAAGGAGGAACGG + Intronic
1169187463 20:3630706-3630728 GTGTAGTAAACAAGGACAGATGG + Intronic
1171040863 20:21761907-21761929 GTGTTTTTGACAGTGACAAATGG - Intergenic
1174382015 20:50162061-50162083 GTGTTTTTACCAAGGAGAAAAGG + Intergenic
1177646780 21:23908856-23908878 GTCTTGTTGACAATGACAAATGG + Intergenic
1177676477 21:24307754-24307776 GTGTTGCTGTCAAGGAAAACTGG + Intergenic
1178836565 21:36103420-36103442 GTCCTGTTGACAAAGAAAAATGG - Intergenic
1179070621 21:38067554-38067576 GCGTGATTGACAGGGACAAAAGG - Intronic
1179640994 21:42747182-42747204 CTGCTGTTGACAAAGACAAAAGG - Intronic
1179936043 21:44603769-44603791 GCATTGTTGACCAGGGCAAATGG - Intronic
1182686831 22:32127495-32127517 GTGTTTTTGACATGGGAAAATGG + Intergenic
1183710104 22:39498360-39498382 GTGGTGTTGAAAGGGACAAAGGG - Intergenic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
953135110 3:40175477-40175499 AGGATGTAGACAAGGACAAAAGG - Intronic
954755562 3:52837538-52837560 GGGTTGTTGACAATGGCAAGGGG - Exonic
955218092 3:57001474-57001496 GTTCTGTTAAAAAGGACAAAAGG - Intronic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
957567275 3:81900664-81900686 GTGATCTTGACAAGGACAAGGGG + Intergenic
958993936 3:100879558-100879580 CATTTTTTGACAAGGACAAATGG + Intronic
959136076 3:102422866-102422888 GTGGTGTTGACATTAACAAAGGG + Intronic
959588079 3:108044801-108044823 TTGTTGCAGAAAAGGACAAATGG + Intronic
961524724 3:127489479-127489501 GTGTTGCTGTCATAGACAAAGGG + Intergenic
964556981 3:157950600-157950622 ATTTTGTTGAGAAAGACAAAAGG + Intergenic
965491072 3:169337423-169337445 GTGTTCTTGAAACTGACAAAAGG - Intronic
965775290 3:172223395-172223417 GTTTTGATGACAGTGACAAAAGG + Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
975097284 4:70471801-70471823 GTCTTATTGACAAGGAAATATGG + Intronic
976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG + Intergenic
978078029 4:104557695-104557717 GTGTTGCTGACCTGGACATAGGG + Intergenic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
979782466 4:124670300-124670322 GTCTTGTTGGCAAGGCCATATGG - Exonic
980078674 4:128320894-128320916 ATTTTGTTTACATGGACAAATGG + Intergenic
980984892 4:139685605-139685627 TTTTTGTTGACAAGGGAAAATGG - Intronic
985089430 4:186348381-186348403 GTATTGTTGACAGGGGTAAAAGG - Intergenic
986022434 5:3817090-3817112 ATGTTCTTGACAAGGAGAGAGGG - Intergenic
987041012 5:14062219-14062241 TTGTGTTTGACAGGGACAAATGG - Intergenic
988520789 5:31943932-31943954 GTGCTGGTGACAAAGACATAAGG - Intronic
989153952 5:38326432-38326454 GTGCTGTGAACAAGGACACAGGG - Intronic
989433785 5:41386694-41386716 GTGTTGTAGAGAAGGCCATACGG + Intronic
993398436 5:87419547-87419569 ATTTTGTTGACTAGGACAATGGG - Intergenic
994089119 5:95793071-95793093 GTTTTGTTGAAAAGCACAGATGG + Exonic
995765908 5:115618501-115618523 GGGTTGATGGCAAGGAAAAAAGG - Intronic
997167738 5:131679313-131679335 GTGTTGTTGACAAGGAAAGAAGG - Intronic
997799008 5:136841101-136841123 GAGATGAGGACAAGGACAAAAGG + Intergenic
998345446 5:141458023-141458045 GTTCTGTTGACAAAGAAAAATGG + Intronic
998799800 5:145857297-145857319 GTGGTGTTAAAAAGGACAAAAGG - Intergenic
1000146567 5:158458920-158458942 GTGCTGTTTAAAAGGAAAAAAGG + Intergenic
1000595058 5:163205944-163205966 GTGGTGTTGTAAAGGACAAGTGG + Intergenic
1001684525 5:173583599-173583621 GTGTGGTAGACAAGGAGAAGAGG + Intergenic
1003002449 6:2348802-2348824 GAGTTGTGTAGAAGGACAAAGGG + Intergenic
1003221551 6:4165056-4165078 GTGTTGGGGACAAGAAGAAAAGG + Intergenic
1003471295 6:6436589-6436611 ATGTGGTTGACAAAGAAAAAGGG + Intergenic
1004456952 6:15800135-15800157 CTTATGTTGACAAGGACAAGAGG - Intergenic
1005119558 6:22374978-22375000 GTCCTGTTGACAAAGAAAAATGG - Intergenic
1006129527 6:31860974-31860996 GTCCTGTTGACAATGCCAAATGG + Intronic
1009814808 6:68718925-68718947 GTAGTGATGACAGGGACAAATGG + Intronic
1010184776 6:73130989-73131011 ATGTAGTTGAGAAGGACAAAAGG + Intronic
1011749815 6:90443754-90443776 GTTTTGGTGACAGGGACTAAGGG + Intergenic
1012807176 6:103908941-103908963 GTGTTCTAGACAAGGACTAGGGG + Intergenic
1013788115 6:113805989-113806011 CTGTTGTTAATACGGACAAATGG - Intergenic
1015544743 6:134349745-134349767 GTGGTGTGGACAGGGACCAATGG + Intergenic
1015740685 6:136450224-136450246 GTGTTGGTGAAAAGGATAAAAGG - Intronic
1016181270 6:141150800-141150822 GTCCTGTTGACAAAGAAAAATGG + Intergenic
1018370843 6:163166254-163166276 TTGTTGTTGAGCAGGGCAAATGG - Intronic
1018642692 6:165919117-165919139 GGCTTGTTGACAAAGCCAAAAGG - Intronic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1024422477 7:49185171-49185193 TTGTTGATGACATGGAGAAAAGG + Intergenic
1024426604 7:49233040-49233062 GTGTTGCTGACAAAGGCAAGAGG - Intergenic
1031652968 7:124314460-124314482 GTGGTGGAGACAAGGAGAAAAGG + Intergenic
1031822550 7:126522561-126522583 GTGTTATTAACAAGGAAAAAAGG + Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1034257540 7:149732884-149732906 GTGTTGTTGATGAGACCAAATGG - Intronic
1034486569 7:151368572-151368594 CTGTTATTAACAAGTACAAATGG - Intronic
1034972308 7:155426943-155426965 GTGTTGTTGATAAGCAAAACTGG - Intergenic
1037236786 8:16729590-16729612 ATTTAGTTGACAAGGAAAAAGGG + Intergenic
1037320844 8:17641115-17641137 GTGCTGTTGGCAGGGACAGAGGG - Intronic
1039173322 8:34774137-34774159 GTGATGTTGACAAGGACATGGGG - Intergenic
1040447880 8:47514395-47514417 GTGCTGATGACATGGAGAAAAGG + Intronic
1040641698 8:49342259-49342281 GTGTAGTTGACATGGAAAACAGG + Intergenic
1041567210 8:59292537-59292559 GTATTTTTGAAAATGACAAAAGG + Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043091902 8:75914812-75914834 GTGTTGTTGCCAAAAACTAAGGG - Intergenic
1044191681 8:89326458-89326480 TTATTTTTGACAAGGACAAGGGG - Intergenic
1044481815 8:92699450-92699472 GTGTAGATCACAAGGACTAAAGG - Intergenic
1045205570 8:100036281-100036303 ATGGTGTTGGCAAGGAGAAAGGG - Intronic
1045631816 8:104133259-104133281 GAGTTGTTTACAAAGACAAATGG + Intronic
1045683261 8:104685195-104685217 TGCTTGTTGACAAGGTCAAATGG + Intronic
1046384562 8:113492346-113492368 CTGTTGTTGAGAATGCCAAATGG - Intergenic
1048535046 8:135285197-135285219 GCCTTGTTGCCCAGGACAAATGG + Intergenic
1048599034 8:135899268-135899290 GTGTTATTCACATGGAGAAAAGG - Intergenic
1048955573 8:139533402-139533424 GTGTCCTCGGCAAGGACAAAAGG + Intergenic
1049643130 8:143724544-143724566 GTGTTGGTGACAAAGAGGAAAGG + Exonic
1051339905 9:16101708-16101730 GTGTTGTGGAGAAGGCCACAGGG + Intergenic
1051779930 9:20679080-20679102 GTGTAGAAGACAAGGTCAAAGGG + Intronic
1054222701 9:62428901-62428923 ATATTGTTGACAAGGCTAAATGG + Intergenic
1054228009 9:62480275-62480297 ATATTGTTGACAAGGCTAAATGG - Intergenic
1058151701 9:101470612-101470634 GTATGGTTGAGAAGGACAAGAGG + Intergenic
1186892584 X:13973739-13973761 GTGTTTTGGAAGAGGACAAATGG - Intergenic
1188090983 X:25965178-25965200 TTGTAGTTGACAAATACAAACGG - Intergenic
1189272907 X:39764284-39764306 GGGTTGTTGAGAAGGTTAAATGG + Intergenic
1189585653 X:42459043-42459065 GTGTTTTTGCCAGGGCCAAATGG + Intergenic
1192777277 X:74258427-74258449 GTCCTGTTGACAAAGAAAAATGG - Intergenic
1194042972 X:88964922-88964944 GTGATATTTACAAGTACAAAAGG - Intergenic
1194319750 X:92429798-92429820 GGTTTGTTGATAAGGAGAAAAGG + Intronic
1196416944 X:115481310-115481332 GTTCTGTTGACAAGGAAGAAGGG + Intergenic
1200627875 Y:5542931-5542953 GGTTTGTTGATAAGGAGAAAAGG + Intronic
1201562601 Y:15333703-15333725 GTGTTCTGGACATGGACATAAGG + Intergenic
1202180510 Y:22135859-22135881 GTGCTGTTGACAAGGAAGAGTGG + Intergenic
1202210850 Y:22450540-22450562 GTGCTGTTGACAAGGAAGAGTGG - Intergenic