ID: 1043068509

View in Genome Browser
Species Human (GRCh38)
Location 8:75607786-75607808
Sequence TGGTGTATGAACATGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043068509_1043068512 -5 Left 1043068509 8:75607786-75607808 CCCAGATACATGTTCATACACCA No data
Right 1043068512 8:75607804-75607826 CACCATGTTGGAATTAACAATGG No data
1043068509_1043068515 10 Left 1043068509 8:75607786-75607808 CCCAGATACATGTTCATACACCA No data
Right 1043068515 8:75607819-75607841 AACAATGGGAGAGTAGTATGAGG No data
1043068509_1043068513 -4 Left 1043068509 8:75607786-75607808 CCCAGATACATGTTCATACACCA No data
Right 1043068513 8:75607805-75607827 ACCATGTTGGAATTAACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043068509 Original CRISPR TGGTGTATGAACATGTATCT GGG (reversed) Intergenic
No off target data available for this crispr