ID: 1043068856

View in Genome Browser
Species Human (GRCh38)
Location 8:75612778-75612800
Sequence CTATATAAATAGATGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043068856_1043068861 -9 Left 1043068856 8:75612778-75612800 CCCAACCCCATCTATTTATATAG No data
Right 1043068861 8:75612792-75612814 TTTATATAGACTCTCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043068856 Original CRISPR CTATATAAATAGATGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr