ID: 1043074932

View in Genome Browser
Species Human (GRCh38)
Location 8:75686273-75686295
Sequence AAAACACTTAAAACCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043074932_1043074934 26 Left 1043074932 8:75686273-75686295 CCAGGCTTGGTTTTAAGTGTTTT No data
Right 1043074934 8:75686322-75686344 CTTATGATTGGTATTATTCATGG No data
1043074932_1043074935 30 Left 1043074932 8:75686273-75686295 CCAGGCTTGGTTTTAAGTGTTTT No data
Right 1043074935 8:75686326-75686348 TGATTGGTATTATTCATGGCTGG No data
1043074932_1043074933 14 Left 1043074932 8:75686273-75686295 CCAGGCTTGGTTTTAAGTGTTTT No data
Right 1043074933 8:75686310-75686332 ATGCTTAACATGCTTATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043074932 Original CRISPR AAAACACTTAAAACCAAGCC TGG (reversed) Intergenic
No off target data available for this crispr