ID: 1043087231

View in Genome Browser
Species Human (GRCh38)
Location 8:75849727-75849749
Sequence TACGCGGGTGTGCACACACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043087231_1043087235 -5 Left 1043087231 8:75849727-75849749 CCGAGTGTGTGCACACCCGCGTA No data
Right 1043087235 8:75849745-75849767 GCGTAGGCCTTGACAGCCCCTGG No data
1043087231_1043087237 1 Left 1043087231 8:75849727-75849749 CCGAGTGTGTGCACACCCGCGTA No data
Right 1043087237 8:75849751-75849773 GCCTTGACAGCCCCTGGGCTTGG No data
1043087231_1043087243 29 Left 1043087231 8:75849727-75849749 CCGAGTGTGTGCACACCCGCGTA No data
Right 1043087243 8:75849779-75849801 CTTTGCTCTGAGATCAGAGCAGG No data
1043087231_1043087236 -4 Left 1043087231 8:75849727-75849749 CCGAGTGTGTGCACACCCGCGTA No data
Right 1043087236 8:75849746-75849768 CGTAGGCCTTGACAGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043087231 Original CRISPR TACGCGGGTGTGCACACACT CGG (reversed) Intergenic
No off target data available for this crispr