ID: 1043092553

View in Genome Browser
Species Human (GRCh38)
Location 8:75924150-75924172
Sequence GCCAACCGGAGCCGCAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043092553_1043092561 13 Left 1043092553 8:75924150-75924172 CCATCATTGCGGCTCCGGTTGGC No data
Right 1043092561 8:75924186-75924208 CCGTCAGTGCCAGTGAGATGGGG No data
1043092553_1043092558 11 Left 1043092553 8:75924150-75924172 CCATCATTGCGGCTCCGGTTGGC No data
Right 1043092558 8:75924184-75924206 TGCCGTCAGTGCCAGTGAGATGG No data
1043092553_1043092559 12 Left 1043092553 8:75924150-75924172 CCATCATTGCGGCTCCGGTTGGC No data
Right 1043092559 8:75924185-75924207 GCCGTCAGTGCCAGTGAGATGGG No data
1043092553_1043092562 21 Left 1043092553 8:75924150-75924172 CCATCATTGCGGCTCCGGTTGGC No data
Right 1043092562 8:75924194-75924216 GCCAGTGAGATGGGGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043092553 Original CRISPR GCCAACCGGAGCCGCAATGA TGG (reversed) Intergenic
No off target data available for this crispr