ID: 1043102330

View in Genome Browser
Species Human (GRCh38)
Location 8:76061240-76061262
Sequence CTCAGGAAACATAATCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043102330_1043102334 -5 Left 1043102330 8:76061240-76061262 CCACCATGATTATGTTTCCTGAG No data
Right 1043102334 8:76061258-76061280 CTGAGGCCTCTCCAGCCATATGG 0: 14
1: 308
2: 2767
3: 7179
4: 7664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043102330 Original CRISPR CTCAGGAAACATAATCATGG TGG (reversed) Intergenic
No off target data available for this crispr