ID: 1043102334

View in Genome Browser
Species Human (GRCh38)
Location 8:76061258-76061280
Sequence CTGAGGCCTCTCCAGCCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17932
Summary {0: 14, 1: 308, 2: 2767, 3: 7179, 4: 7664}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043102328_1043102334 5 Left 1043102328 8:76061230-76061252 CCTTCACCTTCCACCATGATTAT 0: 70
1: 802
2: 1876
3: 3962
4: 5132
Right 1043102334 8:76061258-76061280 CTGAGGCCTCTCCAGCCATATGG 0: 14
1: 308
2: 2767
3: 7179
4: 7664
1043102330_1043102334 -5 Left 1043102330 8:76061240-76061262 CCACCATGATTATGTTTCCTGAG No data
Right 1043102334 8:76061258-76061280 CTGAGGCCTCTCCAGCCATATGG 0: 14
1: 308
2: 2767
3: 7179
4: 7664
1043102329_1043102334 -1 Left 1043102329 8:76061236-76061258 CCTTCCACCATGATTATGTTTCC No data
Right 1043102334 8:76061258-76061280 CTGAGGCCTCTCCAGCCATATGG 0: 14
1: 308
2: 2767
3: 7179
4: 7664
1043102332_1043102334 -8 Left 1043102332 8:76061243-76061265 CCATGATTATGTTTCCTGAGGCC 0: 31
1: 89
2: 141
3: 102
4: 279
Right 1043102334 8:76061258-76061280 CTGAGGCCTCTCCAGCCATATGG 0: 14
1: 308
2: 2767
3: 7179
4: 7664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043102334 Original CRISPR CTGAGGCCTCTCCAGCCATA TGG Intergenic
Too many off-targets to display for this crispr