ID: 1043102382

View in Genome Browser
Species Human (GRCh38)
Location 8:76061686-76061708
Sequence AGCAAGACAGGCCCATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043102382_1043102386 10 Left 1043102382 8:76061686-76061708 CCATGTGATGGGCCTGTCTTGCT No data
Right 1043102386 8:76061719-76061741 CCATGAGTTAAAGCTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043102382 Original CRISPR AGCAAGACAGGCCCATCACA TGG (reversed) Intergenic
No off target data available for this crispr