ID: 1043103386

View in Genome Browser
Species Human (GRCh38)
Location 8:76076498-76076520
Sequence TCCATCCTGAAAAAAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043103386_1043103387 2 Left 1043103386 8:76076498-76076520 CCAGAAATTTTTTTCAGGATGGA No data
Right 1043103387 8:76076523-76076545 CAAGAGTAGATGATATACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043103386 Original CRISPR TCCATCCTGAAAAAAATTTC TGG (reversed) Intergenic
No off target data available for this crispr