ID: 1043104470

View in Genome Browser
Species Human (GRCh38)
Location 8:76090288-76090310
Sequence ATAAGGCATCTGGTGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043104470_1043104484 30 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104484 8:76090341-76090363 TGGCTTCTCTGGGCTTGAGCTGG No data
1043104470_1043104478 6 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104478 8:76090317-76090339 GACCCTGTGAAATATAGTCAGGG No data
1043104470_1043104483 20 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104483 8:76090331-76090353 TAGTCAGGGATGGCTTCTCTGGG No data
1043104470_1043104482 19 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104482 8:76090330-76090352 ATAGTCAGGGATGGCTTCTCTGG No data
1043104470_1043104477 5 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104477 8:76090316-76090338 GGACCCTGTGAAATATAGTCAGG No data
1043104470_1043104481 10 Left 1043104470 8:76090288-76090310 CCAAATTCCACCAGATGCCTTAT No data
Right 1043104481 8:76090321-76090343 CTGTGAAATATAGTCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043104470 Original CRISPR ATAAGGCATCTGGTGGAATT TGG (reversed) Intergenic
No off target data available for this crispr