ID: 1043107912

View in Genome Browser
Species Human (GRCh38)
Location 8:76138187-76138209
Sequence GGTGTACAGAAGCTGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043107912_1043107918 20 Left 1043107912 8:76138187-76138209 CCCATCCTCAGCTTCTGTACACC No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043107912 Original CRISPR GGTGTACAGAAGCTGAGGAT GGG (reversed) Intergenic
No off target data available for this crispr