ID: 1043107918

View in Genome Browser
Species Human (GRCh38)
Location 8:76138230-76138252
Sequence TGATTACAAGCCTATTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043107912_1043107918 20 Left 1043107912 8:76138187-76138209 CCCATCCTCAGCTTCTGTACACC No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data
1043107914_1043107918 15 Left 1043107914 8:76138192-76138214 CCTCAGCTTCTGTACACCAACAC No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data
1043107916_1043107918 -1 Left 1043107916 8:76138208-76138230 CCAACACTGGCCTTTTAGTTACT No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data
1043107910_1043107918 27 Left 1043107910 8:76138180-76138202 CCTGTTCCCCATCCTCAGCTTCT No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data
1043107913_1043107918 19 Left 1043107913 8:76138188-76138210 CCATCCTCAGCTTCTGTACACCA No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data
1043107911_1043107918 21 Left 1043107911 8:76138186-76138208 CCCCATCCTCAGCTTCTGTACAC No data
Right 1043107918 8:76138230-76138252 TGATTACAAGCCTATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043107918 Original CRISPR TGATTACAAGCCTATTAATC AGG Intergenic
No off target data available for this crispr