ID: 1043107969

View in Genome Browser
Species Human (GRCh38)
Location 8:76139006-76139028
Sequence CCTAATAGCACCCACCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043107966_1043107969 -3 Left 1043107966 8:76138986-76139008 CCGCAATTATTTTGCGCCAACCT No data
Right 1043107969 8:76139006-76139028 CCTAATAGCACCCACCTAATTGG No data
1043107963_1043107969 27 Left 1043107963 8:76138956-76138978 CCTAATAGCCATTACTTTCAATG No data
Right 1043107969 8:76139006-76139028 CCTAATAGCACCCACCTAATTGG No data
1043107965_1043107969 19 Left 1043107965 8:76138964-76138986 CCATTACTTTCAATGGTAAAAAC 0: 14
1: 240
2: 492
3: 714
4: 821
Right 1043107969 8:76139006-76139028 CCTAATAGCACCCACCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043107969 Original CRISPR CCTAATAGCACCCACCTAAT TGG Intergenic
No off target data available for this crispr