ID: 1043110486

View in Genome Browser
Species Human (GRCh38)
Location 8:76173726-76173748
Sequence TACCTCAAATGTTTGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043110486_1043110487 2 Left 1043110486 8:76173726-76173748 CCATAGATCAAACATTTGAGGTA No data
Right 1043110487 8:76173751-76173773 AGTAGTATCTAATTGCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043110486 Original CRISPR TACCTCAAATGTTTGATCTA TGG (reversed) Intergenic
No off target data available for this crispr