ID: 1043111905

View in Genome Browser
Species Human (GRCh38)
Location 8:76196091-76196113
Sequence TAGTAAAAGCAGAATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043111904_1043111905 -8 Left 1043111904 8:76196076-76196098 CCACAAATGTTAAATTAGTAAAA No data
Right 1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043111905 Original CRISPR TAGTAAAAGCAGAATTAGAG AGG Intergenic
No off target data available for this crispr