ID: 1043112695

View in Genome Browser
Species Human (GRCh38)
Location 8:76207935-76207957
Sequence TGAGTTTACTAGCAATCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043112695_1043112699 8 Left 1043112695 8:76207935-76207957 CCCATGGATTGCTAGTAAACTCA No data
Right 1043112699 8:76207966-76207988 CCACTAGCAAAAAACGAGCAGGG No data
1043112695_1043112697 7 Left 1043112695 8:76207935-76207957 CCCATGGATTGCTAGTAAACTCA No data
Right 1043112697 8:76207965-76207987 ACCACTAGCAAAAAACGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043112695 Original CRISPR TGAGTTTACTAGCAATCCAT GGG (reversed) Intergenic
No off target data available for this crispr