ID: 1043113301

View in Genome Browser
Species Human (GRCh38)
Location 8:76215821-76215843
Sequence CAGCTGTACTCCAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043113301_1043113304 -3 Left 1043113301 8:76215821-76215843 CCATCTTCCCTGGAGTACAGCTG No data
Right 1043113304 8:76215841-76215863 CTGATTTAAACCAAATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043113301 Original CRISPR CAGCTGTACTCCAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr