ID: 1043114270

View in Genome Browser
Species Human (GRCh38)
Location 8:76230155-76230177
Sequence CTGTGGCTGTCTTGCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043114270_1043114273 0 Left 1043114270 8:76230155-76230177 CCATTTTGGCAAGACAGCCACAG No data
Right 1043114273 8:76230178-76230200 CAAGGCAAGTGTCTGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043114270 Original CRISPR CTGTGGCTGTCTTGCCAAAA TGG (reversed) Intergenic
No off target data available for this crispr