ID: 1043126760

View in Genome Browser
Species Human (GRCh38)
Location 8:76406123-76406145
Sequence TTGTGAGTAAAGAGCTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043126760 Original CRISPR TTGTGAGTAAAGAGCTACCT TGG (reversed) Intergenic
902039304 1:13481289-13481311 TTTTTAGTAGAGATCTACCTTGG + Intronic
902731078 1:18369163-18369185 GGGTGAGTAAAGAGACACCTGGG + Intronic
907753365 1:57285224-57285246 CTGTGAGTAAAGAGCTAGCTTGG - Intronic
908375531 1:63535516-63535538 TTTTGGGTAGAGATCTACCTGGG + Intronic
918844967 1:189597232-189597254 TTGTGAGTGAAGGGCTCACTGGG + Intergenic
1064765735 10:18669481-18669503 TTATGAGTTCAGAGCTAACTTGG + Intronic
1068015242 10:51507664-51507686 TTGAGAGAAAAGAGCTGACTGGG + Intronic
1070534004 10:77361804-77361826 TTGTGGGTCAAGAGCTGCCCAGG + Intronic
1073386661 10:103131025-103131047 TTCTGAGGAAACAGCTACATAGG - Intronic
1076075718 10:127532334-127532356 TTTAGAGTAAAGAGCTCCTTTGG - Intergenic
1076486635 10:130824069-130824091 TTTTGATTAAAGAGTGACCTGGG - Intergenic
1076987981 11:253168-253190 TTGTTAGTCAAGAGAGACCTAGG + Intergenic
1078211682 11:9275006-9275028 TTGAGAGCCAAGAGCTTCCTAGG + Intergenic
1080027218 11:27627405-27627427 AGGGGAGTAAAGAGCCACCTGGG - Intergenic
1084115665 11:67041667-67041689 TTGTGTGGAGAGGGCTACCTTGG + Intronic
1084539651 11:69777806-69777828 TTGTGAGTAAATGGCTGGCTAGG + Intergenic
1086409946 11:86535031-86535053 TTGAGAGTAAACCTCTACCTAGG - Intronic
1086777188 11:90852666-90852688 TTGTGATGAAGAAGCTACCTGGG + Intergenic
1087890234 11:103529772-103529794 TTGTAAGTAAAGTTTTACCTAGG - Intergenic
1091837592 12:3596476-3596498 TTCTGAGTACAGCTCTACCTGGG + Intergenic
1092905246 12:13095342-13095364 TAGCGAGTAAAGAGTCACCTTGG - Intronic
1093174473 12:15896882-15896904 TTGTGTCTAAAGGGCTAACTGGG + Intronic
1093330239 12:17827160-17827182 TTGTAAGTAAAAAGCTAATTTGG + Intergenic
1096779870 12:53985630-53985652 GTGGGAGTAGAGAGCTGCCTCGG - Exonic
1099889993 12:88579486-88579508 CTGTGGGTAAAGCGCTGCCTGGG - Intronic
1102921346 12:116793928-116793950 CTGTGAGTCAAGAGCAACCTAGG - Intronic
1107136747 13:36953158-36953180 TTGAAAGTAAAAAGCTACTTTGG + Intronic
1108399824 13:50028849-50028871 TTGAGAGGAAAGAGTTGCCTAGG - Intergenic
1110871421 13:80456655-80456677 TTCTGAGTAAAGATTTAGCTGGG + Intergenic
1111158624 13:84362861-84362883 TTGTGAGTGAAGAGACATCTGGG + Intergenic
1113542342 13:111118618-111118640 TTGTGAGAAAAGGGCTTCCAGGG - Intronic
1119225240 14:72940208-72940230 TTTTGTCTAAAGAGCTACCTGGG + Exonic
1123221675 14:106863293-106863315 CTGTGAGTAAAGAGCTCGCTTGG - Intergenic
1126684521 15:51235846-51235868 TTGTGGGTAAAGCGCTATCAGGG + Intronic
1126769602 15:52041958-52041980 TGGTGAGTAAAGAGAGACTTGGG - Intronic
1127569276 15:60225307-60225329 TTGTGATTATAAAGCTAACTAGG - Intergenic
1128475304 15:67992231-67992253 TTGTGGGTAAAAAGCTAGCTTGG + Intergenic
1132501675 16:287186-287208 TTGTGAATAAAGAGTGAGCTTGG + Exonic
1143449587 17:7027842-7027864 TTCTGAGGAGAGAGCTAGCTAGG + Exonic
1149042064 17:52202168-52202190 CTGTGAGTACAGAAATACCTTGG + Intergenic
1149087215 17:52732576-52732598 TTTTGAAGAAAGAGGTACCTGGG - Intergenic
1149460783 17:56828497-56828519 TTTTGAATAAAGAATTACCTAGG - Intronic
1149895516 17:60425883-60425905 CTGTGAGTAAAGAGCCAGCCTGG + Exonic
1152511141 17:80789702-80789724 TTGTGAGTGAGGAGCACCCTTGG + Intronic
1155343237 18:24833997-24834019 TGGAGAGAAAAGAGATACCTTGG + Intergenic
1155840696 18:30638911-30638933 TTCTGAGTTAAGAACTACCTTGG + Intergenic
1156411587 18:36833335-36833357 ATTTGAGGAAAGAGCTTCCTGGG + Intronic
1159141756 18:64404634-64404656 TTGTTAGTGAAGAGATAACTGGG - Intergenic
925159250 2:1672351-1672373 TTATGAGTAATGAACTACTTAGG - Intronic
926696654 2:15774222-15774244 TTGTGCGACAAGAGCTACCTTGG - Intergenic
927059981 2:19407988-19408010 TGGTGAGCAAAGAGCTTCCTAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
942562257 2:177232920-177232942 TGGTGAGTAAAGAGCCAGCTGGG - Intronic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946382389 2:219358167-219358189 TGATAAGTAAAGAGCGACCTTGG + Intergenic
1169988370 20:11472232-11472254 CTGGAGGTAAAGAGCTACCTGGG - Intergenic
1174084078 20:47992834-47992856 TGGAGAGTAAAGACCTCCCTAGG + Intergenic
1178347598 21:31844996-31845018 GTGTGAGTAAAGACAAACCTAGG + Intergenic
1178446733 21:32651316-32651338 TTGTGGGTACAGATCTTCCTTGG + Intronic
1179451329 21:41470331-41470353 TTGTGAGTTTAGAGCTGCCCTGG - Intronic
949847752 3:8389270-8389292 TTGTGTGGAGAGAGCTACCTCGG + Intergenic
950956688 3:17060949-17060971 TTGTGAGAAAAGAGCTTTTTGGG + Intronic
952534418 3:34295022-34295044 TTGTGATTAAAGAGCTTCATTGG + Intergenic
952535833 3:34307879-34307901 GTCTGAGGCAAGAGCTACCTTGG - Intergenic
955214805 3:56976361-56976383 TTTTGAGTAAAGAGTTTTCTAGG - Intronic
956434906 3:69225254-69225276 ATGTGACTTAAGAGATACCTTGG - Intronic
957619115 3:82571818-82571840 TTGTGAACAGAAAGCTACCTAGG - Intergenic
960590341 3:119359746-119359768 TTGTGAGTACAGAACTTCCTAGG - Intronic
971658752 4:29384862-29384884 TTGTGATTAAAAATCTACGTGGG - Intergenic
972923342 4:43971246-43971268 TTATGAGTTAAAAGCTGCCTTGG - Intergenic
974982978 4:68984231-68984253 TTTTGAGTCAAGACCTACCATGG - Intergenic
976677486 4:87719377-87719399 TTGTTAGTAAACAGTTACCTAGG - Intergenic
982673146 4:158346448-158346470 GTGTGAGTGAAGAACTACATTGG - Intronic
983722433 4:170872360-170872382 TTGTGAGAAAACTGCTAACTTGG - Intergenic
985292555 4:188401640-188401662 TTCTGAGTGCAGATCTACCTGGG + Intergenic
987280784 5:16411711-16411733 TTGTGAGGAGGGAGCTGCCTTGG + Intergenic
991238908 5:64433452-64433474 ATGTGAGAGAAGAGCTCCCTAGG + Intergenic
994401786 5:99289288-99289310 TTGTGAGGAAAGAGGGACATGGG + Intergenic
996755028 5:126926636-126926658 TTTTGAGTAAGGAGCTGTCTGGG + Intronic
999096814 5:148986512-148986534 TTGTGAGTTAAGATCTGCCAGGG + Intronic
999938403 5:156514157-156514179 TTGTGAGTAAAGGTCTCCTTAGG + Intronic
1000486112 5:161847163-161847185 TTGTGGGTGGAGAGCTACCAGGG + Intergenic
1005301640 6:24476816-24476838 GTGGGAATAAAGAGCTACATGGG - Intronic
1007491494 6:42226465-42226487 TTGTGAGTCAGGAACTGCCTGGG - Exonic
1008046153 6:46853618-46853640 TAGTAAGTAAAAGGCTACCTAGG - Exonic
1008060988 6:46996786-46996808 TTGGGATTAGAGAGGTACCTGGG + Intergenic
1012200223 6:96397004-96397026 TTGTTAGGGAAGAGCTACATGGG + Intergenic
1012997985 6:105992664-105992686 TTGAGAGAGAAGAGCTACCCAGG - Intergenic
1013139557 6:107318387-107318409 TTTTGAGTAAACAGAGACCTGGG - Intronic
1014462663 6:121716031-121716053 TTGTAAGTAAAAAGTTTCCTTGG - Intergenic
1014553508 6:122817217-122817239 TTGTAAGTAAAGTGCTACGATGG - Intergenic
1016012090 6:139147684-139147706 GTGTGAGTAAAGTGCTTCCTTGG - Intronic
1016448219 6:144154477-144154499 TTGTGTCTACAGAGCTGCCTTGG + Intronic
1020844115 7:13261277-13261299 TTGTCAGAAAAGAACTAGCTCGG - Intergenic
1025690508 7:63751398-63751420 TTGTGAGGAATGAGCCCCCTGGG - Intergenic
1026036254 7:66832571-66832593 TTGTTAGTGAGGACCTACCTAGG + Intergenic
1026330364 7:69346783-69346805 TTGTCAGTACAGACATACCTTGG + Intergenic
1030686104 7:112488537-112488559 TTGTGAGCAAAGAGGTATCAAGG - Intronic
1030750310 7:113224692-113224714 CTGGGAGCAAAGAGTTACCTAGG + Intergenic
1030760846 7:113349096-113349118 TTGACAGTAAAGAGGTGCCTTGG - Intergenic
1035865773 8:3080145-3080167 TTGAAAGTAAATAGCTGCCTGGG + Intronic
1039983359 8:42427805-42427827 TTGTGAGTAAATAGAAACGTGGG + Intronic
1042020711 8:64369901-64369923 TTCTGAGGAAACAGCTGCCTCGG + Intergenic
1043126760 8:76406123-76406145 TTGTGAGTAAAGAGCTACCTTGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045784479 8:105904312-105904334 TTGTAAGGAAAGAGCAATCTTGG + Intergenic
1050909438 9:11049036-11049058 CTATGAGTAAAGTGCAACCTTGG + Intergenic
1056871003 9:90278475-90278497 TTGTCACTAAAGATCTACCTTGG + Intergenic
1056948741 9:91024821-91024843 TGGTGTGAAGAGAGCTACCTGGG + Intergenic
1058303349 9:103405512-103405534 TTTTTAGTAAACAGCTACATGGG - Intergenic
1059769762 9:117414552-117414574 TTGTGCGTAACGAGCTGCCGGGG - Exonic
1187736264 X:22307024-22307046 ATGTGAGTAAAAAGTTATCTTGG + Intergenic
1193342099 X:80360755-80360777 TTATCAGTAAAGAGTTTCCTTGG - Intronic
1196872007 X:120121230-120121252 TTCTGAGCCAAAAGCTACCTAGG + Intergenic
1196964670 X:121042616-121042638 TTGTGATTTGAGAGCTTCCTAGG - Intergenic
1201541812 Y:15112887-15112909 TTGTGAGTAGAAAGCCACCTAGG - Intergenic