ID: 1043131048

View in Genome Browser
Species Human (GRCh38)
Location 8:76461787-76461809
Sequence CAGTTTATGGTGGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043131039_1043131048 4 Left 1043131039 8:76461760-76461782 CCTGTGTTTCCAGTTCTTCTCTT No data
Right 1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG No data
1043131040_1043131048 -5 Left 1043131040 8:76461769-76461791 CCAGTTCTTCTCTTCCTTCAGTT No data
Right 1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043131048 Original CRISPR CAGTTTATGGTGGGGGTGGA AGG Intergenic
No off target data available for this crispr