ID: 1043131048 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:76461787-76461809 |
Sequence | CAGTTTATGGTGGGGGTGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043131039_1043131048 | 4 | Left | 1043131039 | 8:76461760-76461782 | CCTGTGTTTCCAGTTCTTCTCTT | No data | ||
Right | 1043131048 | 8:76461787-76461809 | CAGTTTATGGTGGGGGTGGAAGG | No data | ||||
1043131040_1043131048 | -5 | Left | 1043131040 | 8:76461769-76461791 | CCAGTTCTTCTCTTCCTTCAGTT | No data | ||
Right | 1043131048 | 8:76461787-76461809 | CAGTTTATGGTGGGGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043131048 | Original CRISPR | CAGTTTATGGTGGGGGTGGA AGG | Intergenic | ||
No off target data available for this crispr |