ID: 1043137330

View in Genome Browser
Species Human (GRCh38)
Location 8:76544641-76544663
Sequence ATGCCCATCCAGAAGAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043137330_1043137332 3 Left 1043137330 8:76544641-76544663 CCTTTACTCTTCTGGATGGGCAT No data
Right 1043137332 8:76544667-76544689 TTGTTAGGTCTCTTTATCCATGG No data
1043137330_1043137333 8 Left 1043137330 8:76544641-76544663 CCTTTACTCTTCTGGATGGGCAT No data
Right 1043137333 8:76544672-76544694 AGGTCTCTTTATCCATGGCTTGG No data
1043137330_1043137334 19 Left 1043137330 8:76544641-76544663 CCTTTACTCTTCTGGATGGGCAT No data
Right 1043137334 8:76544683-76544705 TCCATGGCTTGGAGTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043137330 Original CRISPR ATGCCCATCCAGAAGAGTAA AGG (reversed) Intergenic
No off target data available for this crispr