ID: 1043140440

View in Genome Browser
Species Human (GRCh38)
Location 8:76581998-76582020
Sequence TTGTATTTGCTTAAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043140435_1043140440 -3 Left 1043140435 8:76581978-76582000 CCTCTTCTGATGCTTCCTTATTG No data
Right 1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG No data
1043140434_1043140440 -2 Left 1043140434 8:76581977-76581999 CCCTCTTCTGATGCTTCCTTATT No data
Right 1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043140440 Original CRISPR TTGTATTTGCTTAAAGGGGA AGG Intergenic
No off target data available for this crispr