ID: 1043146361

View in Genome Browser
Species Human (GRCh38)
Location 8:76660690-76660712
Sequence AAAGCACTTATCACCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043146358_1043146361 18 Left 1043146358 8:76660649-76660671 CCTCAGTGGGGAGCTATGTGGAT No data
Right 1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG No data
1043146356_1043146361 22 Left 1043146356 8:76660645-76660667 CCTACCTCAGTGGGGAGCTATGT No data
Right 1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043146361 Original CRISPR AAAGCACTTATCACCATGCC TGG Intergenic
No off target data available for this crispr