ID: 1043147990

View in Genome Browser
Species Human (GRCh38)
Location 8:76680465-76680487
Sequence GACGGTTGCAAGAATGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043147990_1043147994 -7 Left 1043147990 8:76680465-76680487 CCCCCATCATTCTTGCAACCGTC No data
Right 1043147994 8:76680481-76680503 AACCGTCACTTATTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043147990 Original CRISPR GACGGTTGCAAGAATGATGG GGG (reversed) Intergenic
No off target data available for this crispr