ID: 1043148294

View in Genome Browser
Species Human (GRCh38)
Location 8:76682327-76682349
Sequence TTAGTGTGCGGGGCTGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043148279_1043148294 12 Left 1043148279 8:76682292-76682314 CCCCTCTTCCCCTTCTCAAGTTC 0: 1
1: 0
2: 4
3: 56
4: 521
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148286_1043148294 -10 Left 1043148286 8:76682314-76682336 CCCCGAAGGTCGCTTAGTGTGCG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148280_1043148294 11 Left 1043148280 8:76682293-76682315 CCCTCTTCCCCTTCTCAAGTTCC 0: 1
1: 1
2: 3
3: 55
4: 655
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148284_1043148294 3 Left 1043148284 8:76682301-76682323 CCCTTCTCAAGTTCCCCGAAGGT 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148274_1043148294 29 Left 1043148274 8:76682275-76682297 CCTCCTTTTACCACCCGCCCCTC 0: 1
1: 0
2: 2
3: 18
4: 272
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148278_1043148294 15 Left 1043148278 8:76682289-76682311 CCGCCCCTCTTCCCCTTCTCAAG 0: 1
1: 0
2: 5
3: 72
4: 761
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148276_1043148294 19 Left 1043148276 8:76682285-76682307 CCACCCGCCCCTCTTCCCCTTCT 0: 1
1: 0
2: 9
3: 211
4: 1987
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148281_1043148294 10 Left 1043148281 8:76682294-76682316 CCTCTTCCCCTTCTCAAGTTCCC 0: 1
1: 1
2: 5
3: 70
4: 695
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148275_1043148294 26 Left 1043148275 8:76682278-76682300 CCTTTTACCACCCGCCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 324
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148277_1043148294 16 Left 1043148277 8:76682288-76682310 CCCGCCCCTCTTCCCCTTCTCAA 0: 1
1: 1
2: 2
3: 87
4: 821
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148282_1043148294 4 Left 1043148282 8:76682300-76682322 CCCCTTCTCAAGTTCCCCGAAGG 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data
1043148285_1043148294 2 Left 1043148285 8:76682302-76682324 CCTTCTCAAGTTCCCCGAAGGTC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1043148294 8:76682327-76682349 TTAGTGTGCGGGGCTGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043148294 Original CRISPR TTAGTGTGCGGGGCTGGCGG AGG Intronic
No off target data available for this crispr