ID: 1043149949

View in Genome Browser
Species Human (GRCh38)
Location 8:76703372-76703394
Sequence CACACTTCAGTCACCTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043149949_1043149956 7 Left 1043149949 8:76703372-76703394 CCCATTGAGGTGACTGAAGTGTG No data
Right 1043149956 8:76703402-76703424 ATTGTGATTGGTGCTTAATCAGG No data
1043149949_1043149955 -5 Left 1043149949 8:76703372-76703394 CCCATTGAGGTGACTGAAGTGTG No data
Right 1043149955 8:76703390-76703412 GTGTGGGGAGGAATTGTGATTGG No data
1043149949_1043149957 8 Left 1043149949 8:76703372-76703394 CCCATTGAGGTGACTGAAGTGTG No data
Right 1043149957 8:76703403-76703425 TTGTGATTGGTGCTTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043149949 Original CRISPR CACACTTCAGTCACCTCAAT GGG (reversed) Intronic