ID: 1043150632

View in Genome Browser
Species Human (GRCh38)
Location 8:76711024-76711046
Sequence CCTTTTATATTTAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043150628_1043150632 -7 Left 1043150628 8:76711008-76711030 CCAGAACAACACCTTTCCTTTTA 0: 1
1: 1
2: 2
3: 28
4: 260
Right 1043150632 8:76711024-76711046 CCTTTTATATTTAAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043150632 Original CRISPR CCTTTTATATTTAAGGTAGA AGG Intronic
No off target data available for this crispr