ID: 1043153603

View in Genome Browser
Species Human (GRCh38)
Location 8:76749185-76749207
Sequence TATCACATACAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043153603 Original CRISPR TATCACATACAGATGGTGGA AGG (reversed) Intronic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
908704698 1:66939092-66939114 TAGAAAATACAGATGGTGGGAGG - Intronic
912119586 1:106454052-106454074 TGTCACACAGAGATGGTGTAGGG - Intergenic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
916636005 1:166669237-166669259 CATCACCTACAGATTGTTGAAGG + Intergenic
916759475 1:167803572-167803594 AATCACAGCCAGATGGAGGAGGG + Intergenic
921075289 1:211695734-211695756 TCTCACAGACAGCTGGAGGAGGG - Intergenic
921777642 1:219120780-219120802 AATCAGAAACAGATGGTGCAAGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922703723 1:227777814-227777836 TACCCCTTACAGATGGTGGCAGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1063717989 10:8548025-8548047 TATAGCATAAAGATGGAGGAGGG - Intergenic
1064293504 10:14056551-14056573 TTTCAGTTACAGAGGGTGGAGGG - Intronic
1067852949 10:49766907-49766929 TATCACCTACACATTGTTGATGG - Intergenic
1075111458 10:119589062-119589084 TAAAACATACAGAGGGTGGAGGG + Intronic
1076250917 10:128983180-128983202 TTTCAGATACAGAGGCTGGAGGG - Intergenic
1078742111 11:14076580-14076602 CATCATATACTCATGGTGGAAGG + Intronic
1081147509 11:39581207-39581229 TATCACAAACAGAATGTGCAAGG - Intergenic
1081679840 11:44994494-44994516 GATCACATACAGATTGTGTTTGG - Intergenic
1083958097 11:65997966-65997988 TATCACTTCCAGAAGGTGGCTGG - Exonic
1085218473 11:74852440-74852462 TATCTCATAAAGATTCTGGAAGG + Intronic
1086062213 11:82711485-82711507 TTACCCAGACAGATGGTGGATGG - Intergenic
1088888848 11:114029314-114029336 TCTCAGCTCCAGATGGTGGAAGG - Intergenic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1093163441 12:15777083-15777105 TAACAGATATAGATGGAGGAAGG + Intronic
1098821636 12:75238206-75238228 TAACACAGACAGATTTTGGAGGG + Intergenic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1103302543 12:119939049-119939071 TCCCACAAACAGATGGTGGTGGG - Intergenic
1104172614 12:126296933-126296955 TATCACATACATAAGTTGGTGGG - Intergenic
1106211335 13:27650139-27650161 TATCACACACTGATGCTGGGAGG - Intronic
1106211345 13:27650264-27650286 TATCACACACTGATGCTGGGAGG - Intronic
1106795440 13:33200336-33200358 TTCCACATACAGATGGTGGGTGG - Intronic
1111454396 13:88461464-88461486 TATCCCACAGAGATGGGGGAGGG + Intergenic
1112470181 13:99681349-99681371 TATAACTTACAGATGGTTCACGG + Intronic
1113087959 13:106587187-106587209 GATCAGATATAGAGGGTGGAGGG - Intergenic
1114505637 14:23210474-23210496 TATCACATAGAAATGTAGGATGG + Intronic
1114863156 14:26552877-26552899 TACCACATACAGATGGCAGATGG + Intronic
1115380744 14:32736070-32736092 TATCACATATACATTGTAGAGGG + Intronic
1120095539 14:80383902-80383924 GATCACATTGAGATGGTGGGAGG - Intronic
1120504747 14:85341459-85341481 AATCATATAAAGTTGGTGGATGG - Intergenic
1120650576 14:87127784-87127806 TAGCACAAAGAGATGGAGGAAGG + Intergenic
1121349261 14:93160578-93160600 TTGCACATACTGATGGGGGATGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125431733 15:39602215-39602237 TAACACACACAGATGGAGGGAGG + Intronic
1130008906 15:80131753-80131775 TATCAGATGCAGATGGTGGTGGG + Intronic
1131372191 15:91891943-91891965 TAACACAGACAGGTGGTGAATGG + Intronic
1131777836 15:95821935-95821957 TATCACTTGCATATTGTGGAAGG - Intergenic
1133702364 16:8320836-8320858 TAGAACAAAAAGATGGTGGAAGG + Intergenic
1137642253 16:50042780-50042802 AATGACATACAGTTAGTGGATGG + Intergenic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1138999479 16:62492180-62492202 TTAAACAAACAGATGGTGGATGG + Intergenic
1139537373 16:67585530-67585552 TATCACATAAAGATTATTGAAGG - Intronic
1140862661 16:79032040-79032062 TATTACATACAGAAGGAGGCAGG - Intronic
1141151861 16:81569998-81570020 TTTGACAGACAGATGCTGGAGGG - Intronic
1144132259 17:12257986-12258008 TGTCACATACAGGTGTTGGGAGG - Intergenic
1145068515 17:19782029-19782051 CATCACATTCAGATGGCGTAAGG + Exonic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1148992485 17:51678552-51678574 GACCACATACACATGCTGGAGGG - Intronic
1149687942 17:58549014-58549036 TAGCACATCCAGTTGGGGGATGG + Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152314126 17:79570332-79570354 GATTACAGATAGATGGTGGATGG + Intergenic
1152469188 17:80481541-80481563 TATCACACAGAGCTGGTGGGTGG - Intergenic
1152912950 17:83015865-83015887 TTTCACAGACCGATGGTGGGGGG - Intronic
1153161801 18:2214525-2214547 TATCACATTCAGTTGGTTGATGG - Intergenic
1155276007 18:24188103-24188125 TATCACATACTCATTGAGGAAGG + Intronic
1155758876 18:29539232-29539254 TAACACTTACAGATTGTGAATGG + Intergenic
1155934370 18:31740039-31740061 TATCACATTCAGATAGTTGGGGG - Intergenic
1161314053 19:3609617-3609639 TGTCACATAGAGCTGGTGGGAGG + Intergenic
930601728 2:53451502-53451524 TATCACACACAAATGGTGTCTGG + Intergenic
930739151 2:54811476-54811498 TAACACAGAAAGATGGAGGATGG - Intronic
931477465 2:62603870-62603892 TATTACATACAAATGATAGAAGG + Intergenic
934135231 2:88989605-88989627 TCTCACAAATAGATGCTGGATGG - Intergenic
934235077 2:90224156-90224178 TCTCACAAATAGATGCTGGATGG + Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
937772121 2:125731796-125731818 TAAGACATACAGATAGTGGTTGG - Intergenic
938173942 2:129107140-129107162 TATCTCCTGCAGATGGTGGGGGG + Intergenic
938986090 2:136578055-136578077 TATCTTATAGAGATTGTGGAGGG + Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
940334653 2:152512976-152512998 GATCACTTACATATGTTGGAGGG - Intronic
941048339 2:160702131-160702153 TATCAATTACAGATGGTGGCAGG - Intergenic
947489276 2:230579825-230579847 TAGCACACACAGAAGGGGGAAGG - Intergenic
948295904 2:236860317-236860339 AATCACACACAGATGCTGCAAGG - Intergenic
1171503089 20:25609859-25609881 TTCCACATCAAGATGGTGGATGG + Intergenic
1177875424 21:26626061-26626083 AATGACATATAGATGGTGGCAGG - Intergenic
1180858133 22:19061035-19061057 TATCAGCTAATGATGGTGGAAGG - Intronic
1181076269 22:20379393-20379415 TCACACATACTGGTGGTGGAGGG - Intronic
1181442362 22:22943245-22943267 TGTCACATACACAGGGTGCACGG + Intergenic
1184339852 22:43880264-43880286 TATCAGGTCCAGAGGGTGGAAGG - Exonic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
950194745 3:11001175-11001197 TATTAAATAGAGTTGGTGGAAGG + Intronic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG + Intergenic
953342653 3:42148672-42148694 TGTCACATACAAATAGAGGAGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955326736 3:58014429-58014451 AATCACTTCCAGATGGTGGTTGG + Intronic
955458550 3:59152737-59152759 TAACACAAACAGAAGGTGGGAGG - Intergenic
955681908 3:61510715-61510737 AATCACATCAAGATGGTTGATGG + Intergenic
956585753 3:70862773-70862795 TATAAAATACAGAAGATGGAAGG - Intergenic
958271916 3:91510688-91510710 TACCATATTCAGATGGAGGAAGG + Intergenic
958562060 3:95759690-95759712 AATGACATATAGATGGTGGCAGG - Intergenic
961352656 3:126313916-126313938 TTACACAAACAGATGGTAGACGG - Intergenic
962900821 3:139759841-139759863 TATCATACATATATGGTGGAGGG + Intergenic
964085308 3:152810451-152810473 TATCAGTAAAAGATGGTGGAAGG + Intergenic
964412042 3:156408018-156408040 AATCACAGAGAGATTGTGGAAGG + Intronic
965510398 3:169562756-169562778 TATCACATAGAAATGCTGGTAGG + Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
970551961 4:17190606-17190628 TATCATATACTGATGGATGATGG + Intergenic
971085729 4:23273077-23273099 TATCAGATAGAGGTGGGGGATGG + Intergenic
974763557 4:66309247-66309269 TATCACATACATGTGGCTGAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978597676 4:110395951-110395973 TATCACATAAAGATGATGAGAGG - Intronic
979718074 4:123865837-123865859 TATCACTTATTGATGGTGTAGGG + Intergenic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
984033628 4:174637272-174637294 TATCATATAAAGATGGTACATGG + Exonic
984839298 4:184053125-184053147 TATCACATACAGCCGCAGGAGGG + Intergenic
985296507 4:188442666-188442688 TATCACTTCCAGATAATGGAGGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
991465849 5:66911329-66911351 AATCACATGCAAATGGTGGCAGG + Intronic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
995425656 5:112019488-112019510 TATCACATTCAGAGGTTGCAGGG + Intergenic
998134914 5:139669460-139669482 TGTCACTTGCAGATGGCGGAGGG - Intronic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
999069109 5:148724834-148724856 TAGCACATACAGTTGTTGTAAGG - Intergenic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1000420381 5:161031920-161031942 TAGCAGAGACAGATGGTGGAGGG - Intergenic
1001231067 5:169989016-169989038 CATAACATACAGATCATGGAAGG - Intronic
1004487976 6:16085816-16085838 TTTCACATAGGGCTGGTGGAAGG - Intergenic
1006922423 6:37635544-37635566 TATCACCAACAGCTGGTGGGTGG - Exonic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013285492 6:108677654-108677676 GATCACATAGTGATGTTGGATGG + Intronic
1013757617 6:113480145-113480167 TATCCCATACTGCTAGTGGAGGG - Intergenic
1016502606 6:144738500-144738522 TACCACATACAGATGCAGGCAGG + Intronic
1017351643 6:153449442-153449464 AGTCACATACAGATTGTGAAAGG - Intergenic
1018145432 6:160882939-160882961 AGTCACATACAGATTGTGAAAGG + Intergenic
1029449077 7:100630849-100630871 TATCACTCACAGCTGGTGGTGGG - Intronic
1030584437 7:111400034-111400056 TATCACATTCAGATGGAGAGTGG - Intronic
1030956358 7:115857134-115857156 TAGCAAATTCAGATGGTTGAAGG - Intergenic
1032477739 7:132223887-132223909 TATCCCATGGAGATGGAGGAGGG - Intronic
1034532528 7:151705487-151705509 TATCACACACAGCTGGGCGAGGG + Intronic
1035776657 8:2192697-2192719 TATCACACACAGAAAGTTGAAGG + Intergenic
1036151686 8:6305001-6305023 GATCAGATACTGATGGTGGCAGG + Intergenic
1037079680 8:14768729-14768751 GAACACTTACAGATGGAGGAAGG + Intronic
1038203689 8:25442516-25442538 AATTATATAAAGATGGTGGATGG + Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1046515092 8:115249044-115249066 TATAACAAGCAGATGGTGGCTGG + Intergenic
1046649028 8:116816693-116816715 TATCACATAGAGCTGTTGTAAGG - Intronic
1048618778 8:136108863-136108885 TATCAGAAACAGAGGGTGGTGGG - Intergenic
1050032965 9:1405642-1405664 TGTTTCACACAGATGGTGGAAGG - Intergenic
1055163097 9:73155565-73155587 TATCACATACAGCTGGTTAAGGG - Intronic
1057444887 9:95106876-95106898 TATGACATAAAGGTGCTGGAAGG + Intronic
1057755389 9:97831220-97831242 TATCACATGCTGATGATGGCAGG + Intergenic
1058068249 9:100573634-100573656 TATCAAATACAGATATTGGCAGG + Intronic
1061912612 9:133733042-133733064 TCTCACATTCAGCTGCTGGAGGG - Intronic
1062478082 9:136739343-136739365 GATCACAGAAAGATGGGGGAAGG - Intronic
1185524035 X:763329-763351 TGTGACATCCAGATGATGGAGGG + Intergenic
1187358222 X:18598983-18599005 TGCCAAACACAGATGGTGGATGG + Intronic
1188913484 X:35879986-35880008 TATCACAGCCAGATTATGGAAGG + Intergenic
1189204447 X:39226014-39226036 TATCACAGACACATTGTGAAGGG - Intergenic
1191764870 X:64686862-64686884 TATCAGAGTCAGAGGGTGGAGGG + Intergenic
1196298463 X:114026646-114026668 CATCAAATTCATATGGTGGAAGG - Intergenic
1196673822 X:118398434-118398456 CAACAGATACTGATGGTGGAAGG + Exonic
1198622477 X:138529358-138529380 TATAACATATAAATTGTGGAAGG + Intergenic