ID: 1043162847

View in Genome Browser
Species Human (GRCh38)
Location 8:76868265-76868287
Sequence GACAGAAAACCATTAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043162845_1043162847 -8 Left 1043162845 8:76868250-76868272 CCTGTTGGCAGCAGTGACAGAAA No data
Right 1043162847 8:76868265-76868287 GACAGAAAACCATTAGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043162847 Original CRISPR GACAGAAAACCATTAGGATA AGG Intergenic
No off target data available for this crispr