ID: 1043164569

View in Genome Browser
Species Human (GRCh38)
Location 8:76887388-76887410
Sequence CGCTACTTACACTTCAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043164567_1043164569 21 Left 1043164567 8:76887344-76887366 CCAGATCCAAAGTAAGAGACTAC No data
Right 1043164569 8:76887388-76887410 CGCTACTTACACTTCAATTCTGG No data
1043164568_1043164569 15 Left 1043164568 8:76887350-76887372 CCAAAGTAAGAGACTACTTAGTC No data
Right 1043164569 8:76887388-76887410 CGCTACTTACACTTCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043164569 Original CRISPR CGCTACTTACACTTCAATTC TGG Intergenic
No off target data available for this crispr