ID: 1043170711

View in Genome Browser
Species Human (GRCh38)
Location 8:76962429-76962451
Sequence CGGCATTGGAGCTGAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170711_1043170717 8 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170717 8:76962460-76962482 CCCAGCTTCCATTGCAGCATGGG No data
1043170711_1043170715 7 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170715 8:76962459-76962481 ACCCAGCTTCCATTGCAGCATGG No data
1043170711_1043170722 28 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170711_1043170721 19 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170721 8:76962471-76962493 TTGCAGCATGGGTGTATGGTTGG No data
1043170711_1043170719 15 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170711 Original CRISPR CGGCATTGGAGCTGAAATTC AGG (reversed) Intergenic
No off target data available for this crispr