ID: 1043170712

View in Genome Browser
Species Human (GRCh38)
Location 8:76962443-76962465
Sequence GCTGGGTCAAGGAGCGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170712_1043170717 -6 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170717 8:76962460-76962482 CCCAGCTTCCATTGCAGCATGGG No data
1043170712_1043170719 1 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data
1043170712_1043170723 25 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170723 8:76962491-76962513 TGGTGCTAGAGGTGACTGACTGG No data
1043170712_1043170722 14 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170712_1043170715 -7 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170715 8:76962459-76962481 ACCCAGCTTCCATTGCAGCATGG No data
1043170712_1043170721 5 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170721 8:76962471-76962493 TTGCAGCATGGGTGTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170712 Original CRISPR GCTGGGTCAAGGAGCGGCAT TGG (reversed) Intergenic
No off target data available for this crispr