ID: 1043170714

View in Genome Browser
Species Human (GRCh38)
Location 8:76962454-76962476
Sequence CTGCAATGGAAGCTGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170714_1043170723 14 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170723 8:76962491-76962513 TGGTGCTAGAGGTGACTGACTGG No data
1043170714_1043170719 -10 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data
1043170714_1043170721 -6 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170721 8:76962471-76962493 TTGCAGCATGGGTGTATGGTTGG No data
1043170714_1043170724 27 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170724 8:76962504-76962526 GACTGACTGGACATGAGTAAAGG No data
1043170714_1043170722 3 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170714 Original CRISPR CTGCAATGGAAGCTGGGTCA AGG (reversed) Intergenic
No off target data available for this crispr