ID: 1043170719

View in Genome Browser
Species Human (GRCh38)
Location 8:76962467-76962489
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170711_1043170719 15 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data
1043170714_1043170719 -10 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data
1043170712_1043170719 1 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data
1043170713_1043170719 -5 Left 1043170713 8:76962449-76962471 CCGCTCCTTGACCCAGCTTCCAT No data
Right 1043170719 8:76962467-76962489 TCCATTGCAGCATGGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170719 Original CRISPR TCCATTGCAGCATGGGTGTA TGG Intergenic
No off target data available for this crispr