ID: 1043170722

View in Genome Browser
Species Human (GRCh38)
Location 8:76962480-76962502
Sequence GGGTGTATGGTTGGTGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170714_1043170722 3 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170711_1043170722 28 Left 1043170711 8:76962429-76962451 CCTGAATTTCAGCTCCAATGCCG No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170716_1043170722 -3 Left 1043170716 8:76962460-76962482 CCCAGCTTCCATTGCAGCATGGG No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170712_1043170722 14 Left 1043170712 8:76962443-76962465 CCAATGCCGCTCCTTGACCCAGC No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170713_1043170722 8 Left 1043170713 8:76962449-76962471 CCGCTCCTTGACCCAGCTTCCAT No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data
1043170718_1043170722 -4 Left 1043170718 8:76962461-76962483 CCAGCTTCCATTGCAGCATGGGT No data
Right 1043170722 8:76962480-76962502 GGGTGTATGGTTGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170722 Original CRISPR GGGTGTATGGTTGGTGCTAG AGG Intergenic
No off target data available for this crispr