ID: 1043170724

View in Genome Browser
Species Human (GRCh38)
Location 8:76962504-76962526
Sequence GACTGACTGGACATGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043170716_1043170724 21 Left 1043170716 8:76962460-76962482 CCCAGCTTCCATTGCAGCATGGG No data
Right 1043170724 8:76962504-76962526 GACTGACTGGACATGAGTAAAGG No data
1043170718_1043170724 20 Left 1043170718 8:76962461-76962483 CCAGCTTCCATTGCAGCATGGGT No data
Right 1043170724 8:76962504-76962526 GACTGACTGGACATGAGTAAAGG No data
1043170720_1043170724 13 Left 1043170720 8:76962468-76962490 CCATTGCAGCATGGGTGTATGGT No data
Right 1043170724 8:76962504-76962526 GACTGACTGGACATGAGTAAAGG No data
1043170714_1043170724 27 Left 1043170714 8:76962454-76962476 CCTTGACCCAGCTTCCATTGCAG No data
Right 1043170724 8:76962504-76962526 GACTGACTGGACATGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043170724 Original CRISPR GACTGACTGGACATGAGTAA AGG Intergenic
No off target data available for this crispr