ID: 1043171081

View in Genome Browser
Species Human (GRCh38)
Location 8:76967480-76967502
Sequence AGTCAGAGATTAGAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043171081_1043171086 6 Left 1043171081 8:76967480-76967502 CCAGCTGCCTCTAATCTCTGACT No data
Right 1043171086 8:76967509-76967531 GGCAGGAAATCCACAACAGAAGG No data
1043171081_1043171088 21 Left 1043171081 8:76967480-76967502 CCAGCTGCCTCTAATCTCTGACT No data
Right 1043171088 8:76967524-76967546 ACAGAAGGCAGCACATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043171081 Original CRISPR AGTCAGAGATTAGAGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr