ID: 1043172711

View in Genome Browser
Species Human (GRCh38)
Location 8:76985686-76985708
Sequence TTAGGGTATTGGCTTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043172711_1043172717 2 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172717 8:76985711-76985733 GAAAGAATAGTTACTGAGGGAGG No data
1043172711_1043172719 17 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172711_1043172718 7 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172718 8:76985716-76985738 AATAGTTACTGAGGGAGGCATGG No data
1043172711_1043172715 -2 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172715 8:76985707-76985729 AACAGAAAGAATAGTTACTGAGG No data
1043172711_1043172716 -1 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172716 8:76985708-76985730 ACAGAAAGAATAGTTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043172711 Original CRISPR TTAGGGTATTGGCTTTTTAA AGG (reversed) Intronic
901648385 1:10728788-10728810 AAAGGGGAATGGCTTTTTAATGG + Intronic
903538502 1:24082942-24082964 CTAGCGTATTTGCGTTTTAAGGG - Intronic
905528413 1:38656824-38656846 TTTGGGTATTGTCTTTTTTGAGG + Intergenic
906926805 1:50126414-50126436 TTAGAGTATTTACTTTTTAGTGG + Intronic
907013272 1:50985562-50985584 TTGGGATACTAGCTTTTTAAAGG - Intergenic
907135909 1:52139598-52139620 TTAGAATATTGGCTTTCTACAGG + Intergenic
907978623 1:59458675-59458697 TTAAGTTAATGGATTTTTAATGG + Intronic
908523121 1:64964129-64964151 ATGGGGAATTGGCTTATTAATGG - Intronic
910032888 1:82752606-82752628 TTAGGGTAAAGGCATTTTTAAGG - Intergenic
914715551 1:150252067-150252089 TTAGGATATCAACTTTTTAAAGG - Intergenic
915858985 1:159422231-159422253 TTCAGGTATTGGCTTTTGTAGGG + Intergenic
916369720 1:164077983-164078005 TTAGGTCATTGGCATTTTATTGG + Intergenic
916422425 1:164649472-164649494 TTAGGGCATTATCTTTTCAAGGG - Intronic
917939090 1:179899468-179899490 TTAGTGTAGTTGGTTTTTAAAGG + Intronic
918734360 1:188039235-188039257 TTAAAGTATTGGCTTTGTGAAGG + Intergenic
918737387 1:188082738-188082760 TAAGGGCATTGGCTTCTTTAGGG + Intergenic
918849568 1:189668875-189668897 TTAGGTTATTAGCCTTATAATGG + Intergenic
918856529 1:189762734-189762756 TTAGGGTCTCGGGTTTTTATAGG + Intergenic
919110922 1:193217665-193217687 CTAGGGTCTTGGGTTTTTATAGG + Intronic
920314064 1:205065344-205065366 TTAGGCTATGGGTTTCTTAAAGG - Intronic
921453456 1:215337913-215337935 TCCAGGTATTGGTTTTTTAAAGG + Intergenic
921646205 1:217621264-217621286 TTTGGGAATTGGGTTTTAAAAGG - Intronic
922516596 1:226212645-226212667 TTGGGGTATGGGCTCTTTTAGGG + Intergenic
923843256 1:237697639-237697661 TTATGGTACTTGCATTTTAAAGG - Intronic
924041153 1:239985126-239985148 TTAGAGAAATGGCTTTTTCAAGG + Intergenic
924104237 1:240634789-240634811 TTGGGGGATTGGGTCTTTAAAGG - Intergenic
924411114 1:243806929-243806951 ATAGGGAAATTGCTTTTTAATGG - Intronic
924697919 1:246419446-246419468 CTAGGGTCTTGGGTTTTTATAGG + Intronic
1062780782 10:205156-205178 TTTGGAAATTGGCCTTTTAAAGG + Intronic
1063809407 10:9686920-9686942 TAAGGATATTGGATTTTTCAAGG - Intergenic
1065356987 10:24851930-24851952 TCAGTGTCTTGGCTGTTTAAAGG + Intronic
1065554359 10:26900099-26900121 TGAGGGTAATGCCTTTTAAAAGG - Intergenic
1065672647 10:28137729-28137751 TTTAAGTATTGCCTTTTTAAAGG - Intronic
1066658801 10:37720158-37720180 TTAGGGCATTGGGCTTTTAAGGG + Intergenic
1067733902 10:48834117-48834139 TCAGGGAATTGACTTGTTAAAGG + Intronic
1067741732 10:48900597-48900619 TTAAGGAACTGGCTGTTTAATGG + Intronic
1067813604 10:49451991-49452013 TTTGAGTATTGCCTTTTTATTGG + Intergenic
1068258279 10:54542889-54542911 CTAGGGTCTTGGCTTTTTATAGG - Intronic
1068429555 10:56913513-56913535 CTAGGGTCTTGGGTTTTTATAGG + Intergenic
1069298068 10:66872124-66872146 TTAGGATTTGGGCATTTTAATGG - Intronic
1071148689 10:82606972-82606994 TTTGGGGATGGGTTTTTTAAGGG - Intronic
1072389961 10:94973306-94973328 TTAGGTTATTGTCATTTCAATGG - Intronic
1074651376 10:115527630-115527652 GTTGGTAATTGGCTTTTTAATGG + Intronic
1081055118 11:38400166-38400188 TTGGTGTATTGGTTTTTTAGAGG - Intergenic
1082743459 11:56936941-56936963 TTAGGGTAGTGGCTATTTACTGG - Intergenic
1084231571 11:67757339-67757361 CTAGGGTCTTGGGTTTTTTATGG - Intergenic
1086556417 11:88116363-88116385 TCAAAGTATTGGCTTATTAATGG - Intronic
1089449190 11:118579975-118579997 TTAGGATAGTTGCTTTTAAAAGG + Intronic
1090823278 11:130364261-130364283 TTAGGATCTTGGCTATTTAGAGG + Intergenic
1090834793 11:130446565-130446587 TTAGGGAAGTGGCTGTTCAAGGG - Intergenic
1094032695 12:26031278-26031300 TTGGGGTGTTGGAATTTTAAAGG - Intronic
1094057076 12:26278652-26278674 TTAGGATATAAGCTCTTTAAAGG - Intronic
1094682391 12:32678181-32678203 TTAGAGTATTGGAGTTTTACAGG - Intergenic
1094793459 12:33942034-33942056 TTAGGGTATGGGATCTTTCAGGG - Intergenic
1098082299 12:66800650-66800672 TTATGGTAATGTCTTTTTATAGG - Intronic
1100954211 12:99888529-99888551 TTCTGGTAGTGGCTTTCTAAAGG - Intronic
1101137408 12:101758608-101758630 TTAGAGAATTGGCTTTTAAGTGG + Intronic
1101396121 12:104349427-104349449 TTGTGGTAATTGCTTTTTAAAGG + Exonic
1103179531 12:118897936-118897958 TTAGGGTATGGACTTGGTAATGG + Intergenic
1103751629 12:123167989-123168011 TTGGAGTATTGGTTTCTTAAGGG - Intronic
1104791368 12:131484014-131484036 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
1106622602 13:31385562-31385584 TTAGGGTCTGGGGTTTTTATAGG + Intergenic
1106661615 13:31805912-31805934 TTAGACTATTCTCTTTTTAAAGG + Intergenic
1107274753 13:38666113-38666135 TTGGGGTGGTGGCTTTTTTAGGG - Intergenic
1107775779 13:43839375-43839397 TTAGCATAATGGCTTTTAAAGGG + Intronic
1108200889 13:48041941-48041963 TCAGGGTACTGGCTTTTTCTGGG - Intronic
1108361629 13:49673387-49673409 TTTTGGGATTGGCTTTTTGAAGG - Intronic
1108678531 13:52759675-52759697 GTAGGGATTTGGCTTTTTACTGG + Intergenic
1109453945 13:62558191-62558213 TTATAGTATTGTCCTTTTAAGGG - Intergenic
1110786410 13:79533089-79533111 TTAGTGTATTAGCCTTTAAACGG + Intronic
1110818054 13:79882934-79882956 CTAGGGTCTTGGGTTTTTATAGG + Intergenic
1111348081 13:86989872-86989894 TTAGGTTATATGCTCTTTAATGG + Intergenic
1111430574 13:88144567-88144589 TTAGGGTCTCGGGTTTTTATAGG - Intergenic
1112548040 13:100390898-100390920 TGAGGGGATTGACTTTTTAAAGG + Intronic
1112999678 13:105619612-105619634 TAAGCATATTGTCTTTTTAAAGG - Intergenic
1113277581 13:108749806-108749828 TTTGAGTATAGGCTTTTAAATGG - Intronic
1113304162 13:109058430-109058452 TTATGGTATTAGCTTTATTATGG - Intronic
1113557299 13:111248339-111248361 TTAGGTTTTTGGCATTTTGACGG + Intronic
1114889152 14:26895008-26895030 TTGAGGTATTTGCATTTTAATGG - Intergenic
1114959312 14:27864492-27864514 TTTGTGTATTTGCTTTCTAAGGG - Intergenic
1115101636 14:29708254-29708276 TTAGGGCATTGACTATTTAAAGG + Intronic
1115131801 14:30062788-30062810 TTAGGATTTTAGCATTTTAAGGG - Intronic
1115908399 14:38227440-38227462 TTAGTGTGTTGGCTTTTTAAGGG + Intergenic
1116254064 14:42527370-42527392 TTATGGTGCTGTCTTTTTAAAGG - Intergenic
1116300907 14:43181664-43181686 CTAGGATATTGACTTTTTGAAGG - Intergenic
1118475490 14:66112374-66112396 TTAGGGCTTTGGGTGTTTAAGGG - Intergenic
1118806445 14:69241278-69241300 TTATGGTTTTGGATTTTAAACGG + Exonic
1118991518 14:70801203-70801225 TTATGGAATTTGCTTTATAATGG - Intronic
1119021596 14:71120717-71120739 TGAGGATCTTGGATTTTTAAAGG - Intergenic
1119881973 14:78106760-78106782 TTTGGGCATAGGCTCTTTAAAGG + Intergenic
1120325427 14:83018716-83018738 TTTATGTATTGGCCTTTTAATGG + Intergenic
1124656121 15:31508864-31508886 TTAAGGTCTTGGCTTTTTTGTGG + Intronic
1125182290 15:36891001-36891023 TTAGGCTTTTGCGTTTTTAATGG - Exonic
1126272448 15:46836166-46836188 TTAGTATATTGTCTTTATAAGGG - Intergenic
1126948608 15:53853504-53853526 TTTGGGTATATGCTTATTAATGG + Intergenic
1131520949 15:93114554-93114576 CTTGGCTTTTGGCTTTTTAAAGG + Intergenic
1135671746 16:24381562-24381584 TTTGGGGATAGGGTTTTTAAGGG - Intergenic
1136298172 16:29315515-29315537 TTGGGGTGTTGGCTTTCTTAGGG + Intergenic
1137853804 16:51773239-51773261 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
1140861272 16:79020294-79020316 TTAGGGAGGTGACTTTTTAAGGG + Intronic
1140915201 16:79487288-79487310 TCAGAGTAGTGGTTTTTTAAGGG + Intergenic
1141304891 16:82853092-82853114 TTAGGGTAGTGGCTCTTGCATGG + Intronic
1142059818 16:88022019-88022041 TTGGGGTGTTGGCTTTCTTAGGG + Intronic
1142725497 17:1810727-1810749 CTAGGGTCTTGGGTTTTTATAGG - Intronic
1143549624 17:7622163-7622185 TTAGGCTAATGGCTTTTTAAAGG - Intronic
1147201100 17:38801869-38801891 TTTGGGTTTTGACTCTTTAACGG - Exonic
1148004049 17:44410823-44410845 TTAGGGTCTTGCCTTTCTACTGG - Intronic
1149592179 17:57838432-57838454 TTAGGTTTCTGGTTTTTTAAGGG - Exonic
1150127194 17:62645098-62645120 TTAGGGAATTGGCCTTTGGAAGG + Intronic
1151148573 17:72064372-72064394 TTAGGGCATTGGCGTTTTTGTGG + Intergenic
1155338091 18:24785493-24785515 TCAGGGAATTGGCATTTGAAAGG - Intergenic
1155430232 18:25747847-25747869 TTAAGTTTTTGACTTTTTAATGG - Intergenic
1155891306 18:31273229-31273251 TTAGTATATTAGCTTTTTGAAGG - Intergenic
1156654616 18:39270640-39270662 ATAGGGTCTTGGATTTTTCAGGG + Intergenic
1157889445 18:51401168-51401190 TTAAGGAATTGTGTTTTTAAAGG - Intergenic
1158673395 18:59497410-59497432 CTTGGGTATTTTCTTTTTAAAGG - Intronic
1158869985 18:61676838-61676860 TTAGGGGATTGGAATTTTTAAGG + Intergenic
1159696816 18:71569337-71569359 TTTGGGTATTGGTGTATTAAGGG + Intergenic
1163094538 19:15047004-15047026 TTAGGCTTTTGGCTATTTGAAGG - Intergenic
1164024107 19:21334726-21334748 TCAGGTTATTAGTTTTTTAAAGG + Intergenic
1167652757 19:50742049-50742071 TTAGGGTGTTAGGTTTTGAAGGG - Intergenic
1167673660 19:50871194-50871216 TTTGGGGATTGGCAATTTAAAGG + Intronic
925563038 2:5218925-5218947 TTAGTGTTTTGGATTTTTATTGG - Intergenic
926511481 2:13785842-13785864 TCAAGGTATGGGCTTCTTAAAGG - Intergenic
930274078 2:49291353-49291375 TTAGTGAATTGGTATTTTAAAGG - Intergenic
930337589 2:50069468-50069490 TTATGGTATTTTATTTTTAATGG - Intronic
931027599 2:58130501-58130523 TTAGCGTATTGGATTATTAAAGG - Intronic
932385495 2:71328551-71328573 TTTTGTTATTTGCTTTTTAAGGG + Intronic
932890711 2:75594964-75594986 ATAGAGTATTGTCTTTTTAAAGG - Intergenic
932915945 2:75858210-75858232 TTAGTGTATTGAATTTATAAAGG - Intergenic
933398791 2:81765409-81765431 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
933970237 2:87464089-87464111 TTACTCTTTTGGCTTTTTAAGGG + Intergenic
936323544 2:111486407-111486429 TTACTCTTTTGGCTTTTTAAGGG - Intergenic
937556663 2:123166314-123166336 TTAGGGTATTGTCTTCTAATTGG - Intergenic
937873724 2:126804601-126804623 CTAGGGTCTTGGGTTTTTACAGG + Intergenic
938510248 2:131935442-131935464 ATAGGTTATTGGTTTTTAAAAGG - Intergenic
940187080 2:150997685-150997707 TTAGGCAATTGGTTTATTAAAGG + Intergenic
941158322 2:162005239-162005261 TTAGGTTTAGGGCTTTTTAAGGG + Intronic
942478905 2:176360844-176360866 TTAATGTATAGGCTTTTAAATGG + Intergenic
942757947 2:179364156-179364178 TTTGGGAATTTGTTTTTTAAAGG + Intergenic
943620679 2:190144282-190144304 TTAGGGTACTTTCTTTTTAGTGG - Intronic
944145135 2:196499170-196499192 TCAGTGTATTGGCTTTTTCTGGG + Intronic
944985014 2:205166638-205166660 TTAGGGTTTTGGGTTTTTTGGGG + Intronic
947234930 2:227930858-227930880 TTAGAGTATTATCCTTTTAAAGG + Intergenic
1169722139 20:8690255-8690277 TCAGTGTATTGGCTTTTTCTAGG - Intronic
1170416359 20:16147010-16147032 TGAGGGTATTGGCTATTTTGAGG - Intergenic
1170909339 20:20549178-20549200 TTGTGGTATTAGCTTGTTAAAGG - Intronic
1171368375 20:24642951-24642973 TTAGGTTAGTTGCATTTTAATGG + Intronic
1171449228 20:25224446-25224468 GTAGGGCCTTGGCTTCTTAAGGG - Intronic
1172819052 20:37715991-37716013 TTTGGGTATTTTTTTTTTAAAGG + Intronic
1173425902 20:42943341-42943363 TTTGGGGATTGGCTTGTGAAGGG + Intronic
1174126708 20:48311844-48311866 CTAGGGTCTCGGGTTTTTAAAGG + Intergenic
1176728614 21:10466480-10466502 TTGAAGTATTGACTTTTTAAAGG + Intergenic
1176783575 21:13227883-13227905 ATAGGTTATTGGTTTTTAAAAGG + Intergenic
1176969179 21:15246399-15246421 TTGGTGTATGGGCTTTTTTATGG - Intergenic
1176975809 21:15320409-15320431 TTAGGGTCTTGGTTTGTTTAAGG + Intergenic
1177229968 21:18306763-18306785 TTAGGGTAGTGTTTTTTTAATGG - Intronic
1177981222 21:27916658-27916680 ATAGGTTATTGGTTTTTAAAAGG + Intergenic
1178422399 21:32452912-32452934 CTAGGGTCTTGGGTTTTTTATGG + Intronic
1181044022 22:20206191-20206213 CTAGGGTCTTGGGTTTTTATAGG + Intergenic
1181451715 22:23027069-23027091 CTAGGGTCTTGGGTTTTTATAGG + Intergenic
1182535387 22:30998382-30998404 TTGGGGTCATGGCTTTTTATAGG + Intergenic
1184249360 22:43251382-43251404 TTAGGATGTGGGCATTTTAAGGG - Intronic
949699979 3:6745552-6745574 GTAGGGTAGAGGCTTTTCAAAGG + Intergenic
950987155 3:17386015-17386037 TTGGGATATTTGATTTTTAAGGG - Intronic
952108530 3:30096153-30096175 TTGGGGGATTGGGTTTTTTAAGG + Intergenic
952911510 3:38192338-38192360 TTAGAGTATTGGCTGATTCAGGG - Intronic
956876955 3:73473373-73473395 TTTGGGTATTGACATTTTGATGG + Intronic
957048114 3:75392188-75392210 CTAGGGTCTTGGGTTTTTTATGG - Intergenic
957573374 3:81977749-81977771 TTAGGGGATTAGCTGTTTTACGG + Intergenic
957913501 3:86654862-86654884 TAAGAATATTGCCTTTTTAAGGG - Intergenic
959152987 3:102629803-102629825 TTAGTGCATTGGCTTTTTCTGGG + Intergenic
961880186 3:130056298-130056320 CTAGGGTCTTGGGTTTTTTATGG - Intergenic
964653506 3:159040117-159040139 TTAAGGTATTTGTTTATTAATGG - Intronic
966406213 3:179601052-179601074 TTAGTGTATTTGCTTTGGAAAGG - Intronic
968168542 3:196489184-196489206 TTAGGGTTTTGGGTTTGAAATGG + Intronic
968992573 4:3924645-3924667 CTAGGGTCTTGGGTTTTTTATGG - Intergenic
969071090 4:4539975-4539997 TCACAGTATTGGCTTTTTAAGGG - Intronic
969278686 4:6154551-6154573 TTTCGGTATTGCCTTTTTCAAGG - Intronic
969822778 4:9732977-9732999 CTAGGGTCTTGGGTTTTTTATGG + Intergenic
969930605 4:10627406-10627428 TGTGGCTAATGGCTTTTTAAAGG - Intronic
970535231 4:17023549-17023571 TAAGGGTGTTAGCTTTTCAAAGG + Intergenic
972250155 4:37291458-37291480 TTAGTATAATGGATTTTTAAGGG + Intronic
972644914 4:40958506-40958528 TTAGGCTTTTGGATTTTTAAGGG - Intronic
974035913 4:56818096-56818118 TTAGCATAGTGGCTTTTCAATGG - Intronic
976251481 4:83056269-83056291 TAAGGGTATATGCATTTTAAAGG + Intronic
977427185 4:96882159-96882181 TTATGGTATGGGCTTTTTAATGG + Intergenic
978474623 4:109111783-109111805 TTAGGCTATAGGCTCTTCAAAGG + Intronic
979160606 4:117455899-117455921 TTTTGACATTGGCTTTTTAATGG - Intergenic
980031031 4:127830809-127830831 TTATGAAATTGCCTTTTTAATGG + Intronic
980756784 4:137174753-137174775 GAAGGGTATAGGCTTTTTCATGG - Intergenic
980778082 4:137462271-137462293 TTAGGTTAGGGGCTTTTCAAAGG - Intergenic
981037528 4:140187860-140187882 TTAGAGTAGTGGCTTCTTGATGG - Intergenic
981039551 4:140210669-140210691 TTAGGGTATTAACATATTAATGG - Intergenic
981322493 4:143409063-143409085 TAAGGGAATGGGCTTGTTAATGG + Intronic
981729500 4:147882854-147882876 ATAGAATATTTGCTTTTTAATGG + Intronic
983868263 4:172794149-172794171 AGAGGTTATTGGCTATTTAAAGG + Intronic
985139915 4:186829354-186829376 TTAGGGCATGGGGGTTTTAAGGG - Intergenic
985337035 4:188906978-188907000 TTATGGTATTTGCTATTTTAAGG - Intergenic
986549202 5:8934231-8934253 TCAGGGTTCTGGCTCTTTAAGGG + Intergenic
987267202 5:16268775-16268797 TTAGTGTTTTGGTTTTTTCATGG + Intergenic
990856714 5:60275544-60275566 ATAGGGTATTGGCATTTTGAAGG + Intronic
992166273 5:74055075-74055097 TTAGGAGAATGGCTTTTCAAGGG - Intergenic
992872576 5:81021846-81021868 TTTGGGGATAGGGTTTTTAAAGG + Intronic
992902847 5:81316271-81316293 TAAGGGTATTGGCTGTTGATGGG - Intergenic
993414896 5:87614967-87614989 TTAAGGTATGTGCTTTTGAAAGG + Intergenic
994886081 5:105563874-105563896 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
996486553 5:124042034-124042056 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
997139304 5:131361975-131361997 CTAGGGTCTTGGGTTTTTATAGG + Intronic
997759167 5:136428285-136428307 TTAGGGTATGTGCCTTTTCAAGG - Intergenic
997780848 5:136656661-136656683 TTAGAGTATGAGCTCTTTAAGGG + Intergenic
998537315 5:142945955-142945977 TTAGAGGCTTGGCTTTTTAAAGG + Intronic
998571811 5:143266801-143266823 TTATTGCATTGCCTTTTTAAAGG + Intergenic
998817734 5:146031018-146031040 GGAGGGTGTTTGCTTTTTAAAGG - Intronic
1002408570 5:179055217-179055239 TTTGGGGATGGGGTTTTTAAGGG + Intergenic
1002434944 5:179225508-179225530 TTAGGGTCTCGGGTTTTTATAGG - Intronic
1002842735 6:920544-920566 TTAGGGTCTTGGGTTTTTATAGG - Intergenic
1002843313 6:924305-924327 CTAGGGTCTTGGGTTTTTATAGG - Intergenic
1003675882 6:8203944-8203966 TTAGGCTGTTGGCCTTTTATGGG - Intergenic
1004417276 6:15436466-15436488 CTAGGGTCTTGGGTTTTTATAGG + Intronic
1005660945 6:27998884-27998906 CTAGGGTCTTGGGTTTTTATAGG + Intergenic
1006345443 6:33477780-33477802 TTATGCTATTGGTGTTTTAAAGG - Intergenic
1007646872 6:43389588-43389610 TTAGGGTCTTAGCTTTATTAGGG - Intergenic
1008355956 6:50553355-50553377 TCAGTGTAATGGCTTTTTTATGG + Intergenic
1009905472 6:69866252-69866274 GTAGGTAATTGGCTTTTTAACGG - Intergenic
1010918267 6:81648085-81648107 ATAGGATTTTGGCTTTTTTAAGG - Intronic
1011339596 6:86299282-86299304 GTAGAGCATTGGCCTTTTAAAGG - Intergenic
1011858992 6:91731701-91731723 TTGAGGTATTGTCTTTTTAATGG - Intergenic
1011916156 6:92509124-92509146 TGAGGTTTTTGGCTTTTGAATGG - Intergenic
1012618131 6:101303030-101303052 TCAGGGCATTGGCTTTTTCTAGG + Intergenic
1012809634 6:103940778-103940800 TCAAGGAATTGGCGTTTTAAAGG + Intergenic
1013159512 6:107528184-107528206 TCAGGGAATTGGTGTTTTAATGG + Intronic
1013292909 6:108733894-108733916 TGGGGGTATTTGCATTTTAATGG + Intergenic
1015531986 6:134229965-134229987 TTTGCATATAGGCTTTTTAATGG - Intronic
1016032388 6:139351350-139351372 TTGGGTTATTGGCTTGTTCATGG + Intergenic
1016574364 6:145551443-145551465 TTTAGGTATCTGCTTTTTAAAGG - Intronic
1018389944 6:163334571-163334593 TTATGGTATTGGCTTATTTTGGG - Intergenic
1021045720 7:15920711-15920733 TTAGGGTATTAGGTATTTTAGGG - Intergenic
1021494403 7:21258605-21258627 TTAATCTCTTGGCTTTTTAAGGG + Intergenic
1024940099 7:54753924-54753946 TCAGGTTCTTGTCTTTTTAATGG - Intronic
1026069331 7:67104117-67104139 TCAGGCTAGTGGCTTTTTCAGGG + Intronic
1026707573 7:72708201-72708223 TCAGGCTAGTGGCTTTTTCAGGG - Intronic
1028682866 7:93557921-93557943 TTAGGGTCTTGCTTTTTCAAGGG - Intronic
1028916963 7:96269778-96269800 TGAGAGGATTGCCTTTTTAAAGG - Intronic
1030972065 7:116071374-116071396 TCAAGGTATTAGGTTTTTAAAGG + Intronic
1031023794 7:116658238-116658260 TTAGGCTATTAGCTTTGAAATGG - Intergenic
1031183498 7:118446476-118446498 GGAGGTTATAGGCTTTTTAAGGG + Intergenic
1031911219 7:127518812-127518834 TTAGCATTTTGGCATTTTAAAGG - Intergenic
1033574264 7:142664982-142665004 TTAGGATATGGGCTTAGTAATGG - Intergenic
1036101823 8:5795495-5795517 CTAGGGTCTTGGATTTTTATGGG - Intergenic
1036198340 8:6743679-6743701 TTAGGTATTTGGCTTTCTAATGG + Intronic
1037106819 8:15118865-15118887 CTATGGTATTGGCTTTTTAAAGG + Intronic
1037745083 8:21636893-21636915 TTAGTGCATTGACTCTTTAAAGG - Intergenic
1042012656 8:64265220-64265242 TAAGGGAAATGGATTTTTAAAGG - Intergenic
1043172711 8:76985686-76985708 TTAGGGTATTGGCTTTTTAAAGG - Intronic
1044772515 8:95651969-95651991 ATTGTGTATTGGCATTTTAAAGG + Intergenic
1046023567 8:108695626-108695648 ATAGGGCATGGGCTTTGTAATGG - Intronic
1046315991 8:112502286-112502308 TTGGGGTGTTGGCTGTTTATTGG - Intronic
1046870199 8:119197343-119197365 CTAGGGTCTTGGGTTTTTATAGG + Intronic
1047875373 8:129131028-129131050 TTAGCGTATTTGTTTTTTAAAGG + Intergenic
1047896075 8:129367828-129367850 TTAGTGTGTCTGCTTTTTAAAGG - Intergenic
1047991995 8:130296184-130296206 TTAGGGTACTAGCTTCTGAAAGG + Intronic
1048313753 8:133346842-133346864 TAAGTGTTTTGGTTTTTTAATGG - Intergenic
1050784860 9:9388214-9388236 CTAGGGTCTTGGGTTTTTATAGG + Intronic
1050983169 9:12046571-12046593 TTAGTGCATTGGCTTTTTTCTGG + Intergenic
1052432880 9:28389998-28390020 TTGGTGTAATGGCTCTTTAAGGG - Intronic
1052886725 9:33656421-33656443 TTAGGGTATGGGCTTAGTAATGG - Intergenic
1053266488 9:36718132-36718154 TTAGTGTATTGTTTTTTAAAGGG - Intergenic
1054784251 9:69195577-69195599 TTAGGGTATAGGGTTTTTGGAGG + Intronic
1203781295 EBV:102373-102395 TTGGGTTATGGGCTTCTTAACGG - Intergenic
1186119644 X:6346040-6346062 TTAAGGTCATGTCTTTTTAATGG + Intergenic
1186572022 X:10724973-10724995 TGGGGGTATTAGCTTTCTAAAGG + Intronic
1187254254 X:17627909-17627931 CTAGGGTTTTTGCATTTTAATGG - Intronic
1189077586 X:37933375-37933397 GTAGGCTATTGGTTTTTTTAAGG - Intronic
1189833391 X:44997524-44997546 CTAGGGTCTTGGGTTTTTATAGG + Intronic
1194805982 X:98328553-98328575 TTAGGGTATTGCTTTTTGAGCGG + Intergenic
1197886413 X:131222626-131222648 TTAGGGAACTGGCTATTCAAAGG + Intergenic
1198868593 X:141152354-141152376 TTTGGAGATAGGCTTTTTAAAGG - Intergenic
1198883372 X:141306332-141306354 CTAGGGTATTGGGTTTTTATGGG - Intergenic
1200163782 X:154022437-154022459 TGAGGGTAATGGCTTTTCTAAGG + Intronic
1200809908 Y:7473546-7473568 TTAGGGTCTTACCATTTTAAAGG + Intergenic
1200969129 Y:9131350-9131372 ATAGGTTATGGGTTTTTTAATGG + Intergenic
1201903641 Y:19067898-19067920 TTAGGGGAGTGGCTCTTGAAAGG - Intergenic
1202141699 Y:21731149-21731171 ATAGGTTATGGGTTTTTTAATGG - Intergenic
1202145166 Y:21772653-21772675 ATAGGTTATGGGTTTTTTAATGG + Intergenic