ID: 1043172712

View in Genome Browser
Species Human (GRCh38)
Location 8:76985697-76985719
Sequence TATTCTTTCTGTTAGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043172712_1043172717 -9 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172717 8:76985711-76985733 GAAAGAATAGTTACTGAGGGAGG No data
1043172712_1043172721 21 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172721 8:76985741-76985763 CCTGCTGGAGCTCACTGCCACGG No data
1043172712_1043172718 -4 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172718 8:76985716-76985738 AATAGTTACTGAGGGAGGCATGG No data
1043172712_1043172719 6 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172712_1043172722 26 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172722 8:76985746-76985768 TGGAGCTCACTGCCACGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043172712 Original CRISPR TATTCTTTCTGTTAGGGTAT TGG (reversed) Intronic
900462568 1:2808686-2808708 TGTTCTTCCTGTTAGGATAACGG + Intergenic
906283333 1:44568809-44568831 TATTCTTTCATTTATGGGATGGG + Intronic
906943789 1:50278320-50278342 TAATCTTTCTGTTAGAGGAAAGG - Intergenic
908106440 1:60848087-60848109 TAATGTTTCTGTTGGGGAATGGG - Intergenic
908590281 1:65624310-65624332 TATTCTTTCAGTTACCCTATGGG + Intronic
908953551 1:69592583-69592605 TTTTCTTTCTGTTAAGATTTTGG + Intronic
910067758 1:83173910-83173932 TTTTCTTGCTGATAGGTTATAGG + Intergenic
911939514 1:104023669-104023691 TATTTTTTCTGTAAGTGTTTTGG + Intergenic
912676552 1:111686819-111686841 TTTTCTTTCTATAAGAGTATTGG - Intronic
913074159 1:115327099-115327121 TCTTCTTTCTTTTATGGTTTGGG - Intronic
915776609 1:158495557-158495579 TATTGTTTCTGTTAGAGAATAGG - Intergenic
917349361 1:174060939-174060961 TTTTTTTTCTTTTAGGGCATAGG - Intergenic
917995421 1:180433856-180433878 TATTCCTTCCCCTAGGGTATAGG - Intronic
918717090 1:187803612-187803634 TTTTCTTTCTGATAACGTATGGG + Intergenic
920136356 1:203772310-203772332 TAATTTTTCTTTTTGGGTATAGG - Intronic
920240476 1:204544520-204544542 TTTTTTTTCTGTTAGGATGTGGG + Exonic
920546013 1:206819111-206819133 TATTTTTTCTTTTAAGGGATGGG + Intronic
922989265 1:229892142-229892164 TATTCTTGTTGTTAGGGTAGAGG + Intergenic
923563748 1:235061207-235061229 TCTTCTTTCTCTTAGTGCATGGG - Intergenic
1064284622 10:13981820-13981842 TGTTCTTCCTGTTAGGGCAGGGG + Intronic
1065159452 10:22904020-22904042 AATACTCTCTGTTAGAGTATGGG - Intergenic
1066266390 10:33779812-33779834 TATTCTTTCTGGGATTGTATTGG - Intergenic
1066584440 10:36917195-36917217 TATTTTTTCTGTGTGGGTACAGG + Intergenic
1070810832 10:79297162-79297184 TATTCCTTCTGTTAGGTATTTGG + Intronic
1071176315 10:82930654-82930676 CATATTTTCTTTTAGGGTATAGG + Intronic
1071928271 10:90436593-90436615 CATTCTTTCTCCCAGGGTATGGG - Intergenic
1072143544 10:92612530-92612552 TATTTCTGCTGTTAGGGGATAGG + Intronic
1072866321 10:99066148-99066170 TATTTGTTCTGTTTGGATATTGG - Intronic
1074597036 10:114876938-114876960 TATTTTTTCTGTTAAGTTACCGG + Intronic
1074683283 10:115932877-115932899 TAGTATTTATGTGAGGGTATAGG - Intronic
1076032188 10:127168909-127168931 TATTTATTCTGTTTGGGCATTGG + Intronic
1079331777 11:19539615-19539637 CATTCTTTTTCTTAGGGGATGGG + Intronic
1085867093 11:80307175-80307197 TATTCTTTCTCTGAAGCTATGGG - Intergenic
1086575209 11:88331759-88331781 TGTTCCTTCTGCTATGGTATGGG + Intronic
1086968093 11:93051298-93051320 TATTATATCTTTTAGTGTATGGG - Intergenic
1088041783 11:105393792-105393814 TATTCTTTCTCTTAGTTTTTAGG - Intergenic
1089852081 11:121507795-121507817 TACTCTTTTTGTTTGTGTATAGG + Intronic
1091874979 12:3926091-3926113 ATGTCTTTCTGTTAGGGTTTTGG + Intergenic
1092547318 12:9463279-9463301 TATTATTTTTGTTTGTGTATAGG + Intergenic
1094505672 12:31059101-31059123 TATTATTTTTGTTTGTGTATAGG - Intergenic
1096964884 12:55618071-55618093 TTTACTTTTTGTTAGTGTATTGG - Intergenic
1097385403 12:58944922-58944944 TTATCTTTCTGTTATGTTATTGG + Intergenic
1097823488 12:64151158-64151180 TATTATTTCTGTTTGGGAAATGG - Exonic
1098071256 12:66677481-66677503 TATCCTTTCTGTTACGGTTTTGG - Intronic
1099099545 12:78421219-78421241 GATTCTTTTGGTTAGGGTCTGGG - Intergenic
1099796528 12:87407992-87408014 TATTCATTCTGATATGGTTTGGG + Intergenic
1099849530 12:88074735-88074757 TATTTCTTCTCCTAGGGTATGGG - Intronic
1103011255 12:117460273-117460295 TATTCTTGGTGTTAGGAAATGGG + Exonic
1105923148 13:24983672-24983694 CATTCCTTCTCCTAGGGTATGGG - Intergenic
1106277209 13:28222544-28222566 TATTTTTTCTGTTTGGTTATTGG + Intronic
1107790974 13:44002023-44002045 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
1108883149 13:55146242-55146264 CATTCCTTCTTTTTGGGTATGGG + Intergenic
1109764747 13:66879985-66880007 TATTCCTTCTGTTTGTGTGTTGG - Intronic
1110462938 13:75766336-75766358 GATTATTTGTGTGAGGGTATAGG + Intronic
1110553529 13:76832830-76832852 GATTGTCTCTATTAGGGTATGGG + Intergenic
1110817373 13:79876874-79876896 TATTCTTTCTGGAAGGCTCTAGG + Intergenic
1111509440 13:89241957-89241979 CATTCTTTCTCCAAGGGTATGGG + Intergenic
1112377425 13:98856126-98856148 TATTTTTTCTGTTAGGAAGTTGG + Intronic
1113143508 13:107181179-107181201 TATTCTGTTTGTTAGTGAATTGG + Intronic
1114373782 14:22120927-22120949 TATTCATCATGTGAGGGTATTGG + Intergenic
1115772948 14:36685662-36685684 TCTTCTTTCTGTTAGAATTTAGG + Intronic
1116211302 14:41948752-41948774 TATTCTTTTTGAGAGGATATTGG + Intergenic
1116577304 14:46590638-46590660 TTTTCTTTTTTTTAAGGTATTGG - Intergenic
1116719156 14:48471373-48471395 TGTTCTTTCAGTGAGTGTATAGG + Intergenic
1117904918 14:60574883-60574905 TTTTCTTTCTGTTCGGGGAAGGG + Intergenic
1119924965 14:78484792-78484814 TATTCTTTCTCTAAGAGAATGGG + Intronic
1120163275 14:81168268-81168290 GACTCCTTCTTTTAGGGTATGGG - Intergenic
1120253579 14:82090058-82090080 TTTTCTTTTTGATAGTGTATAGG + Intergenic
1120448559 14:84635114-84635136 TATTATTTCTCTTAGTATATTGG + Intergenic
1121366451 14:93316425-93316447 TATTTTTTCTGTTGAGGTCTTGG + Intronic
1121842664 14:97147394-97147416 TATTTTTTTTGTTAGGGGAAGGG + Intergenic
1125408412 15:39378878-39378900 AATCATTTCTCTTAGGGTATTGG - Intergenic
1126698618 15:51347528-51347550 TTGTCTTTCTGTTAGGTTAGGGG - Intronic
1130950935 15:88587283-88587305 TTTTCTATCTGATAGGGTTTTGG - Intergenic
1131376470 15:91928348-91928370 TATTCTTTCTGTGTAGGTAAAGG + Intronic
1134205648 16:12235976-12235998 ACTTCTTTCTGCTAGGGTAGGGG + Intronic
1138360906 16:56425920-56425942 TATTCTTTCTTCTGGGGTTTCGG - Intergenic
1139677619 16:68535763-68535785 TATTCATTTTGTTTGGGTTTGGG + Intronic
1146102399 17:29996201-29996223 TAGTCTTTCTGTTTTAGTATTGG - Intronic
1149330341 17:55574847-55574869 TATTCTTTCATTTAGGAAATAGG + Intergenic
1149450851 17:56748781-56748803 TTTTCTTTCTGTTAGTATAAGGG + Intergenic
1149694012 17:58602107-58602129 TATTATTGCTTTTAAGGTATTGG - Intronic
1150930298 17:69577476-69577498 TCTCCTTTCTGTAAGGGTAAAGG + Intergenic
1153148394 18:2059200-2059222 TATTCTTTCTGTTAGATATTAGG - Intergenic
1153490469 18:5642125-5642147 TATTCTTTCTATTCGTGTAATGG - Intergenic
1153712188 18:7810870-7810892 AATTCTTTCTGCTAGGTCATAGG + Intronic
1154509190 18:15077147-15077169 TTTTCTTTCTGTTATGGGCTAGG + Intergenic
1155154176 18:23144308-23144330 TCCTCTTACTGTTAGGGAATTGG - Intronic
1155802070 18:30118460-30118482 TATTATTTCTTTCAGGGAATTGG - Intergenic
1156072751 18:33232597-33232619 TATACTTTCTGTTAGGGTCCTGG - Intronic
1157949704 18:52021098-52021120 CATTTTTTCTGTTAGGTTATTGG + Intergenic
1158003239 18:52643565-52643587 CATTCTTTCTGTAGGGGGATTGG - Intronic
1159451696 18:68611010-68611032 TGTTGTTTTTTTTAGGGTATAGG - Intergenic
1163857821 19:19719363-19719385 TATTGTTCCTGTTAGTGTTTTGG - Intronic
1164889327 19:31809595-31809617 TATTCTTTTTTTTAAGGAATAGG - Intergenic
1167583963 19:50362599-50362621 TAGGTTTTCTGTTAGGGTCTTGG - Intronic
1168585953 19:57592044-57592066 TATTCTTTCTGTGAGACTAGAGG + Exonic
926262341 2:11277235-11277257 TATTCTGTCTGTTACCATATTGG - Intronic
927626057 2:24720033-24720055 TATGATCTCTGTTAGGGAATTGG + Intronic
929413812 2:41727030-41727052 TACTCTTTTATTTAGGGTATTGG - Intergenic
929567182 2:42996410-42996432 TATTCTTTCTATTGAGGTGTAGG + Intergenic
929915998 2:46136300-46136322 TATTCTTTCTGATATGTTAAGGG + Intronic
931876062 2:66514102-66514124 CATTGTTTCTGTTAGTCTATAGG - Intronic
932507321 2:72247761-72247783 CATTCTTTCTGTGAGGGCAGTGG + Intronic
932959995 2:76402474-76402496 TATACTTACTGTTGGGATATAGG - Intergenic
933305395 2:80591332-80591354 TGTTCTTTTTGTTAGGGCAAAGG + Intronic
935486622 2:103663940-103663962 TCTTCTCTCTCTTATGGTATGGG + Intergenic
935586811 2:104807985-104808007 TAGTCTTTTAGTGAGGGTATGGG + Intergenic
937744665 2:125397526-125397548 TTCTCTTGCTGTTAGGGCATGGG + Intergenic
938952650 2:136269666-136269688 TTTTCTTTCTGTAAAGCTATAGG + Intergenic
939255921 2:139744612-139744634 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
940343815 2:152608761-152608783 TATTCATTCTGTTAGAGTTGAGG + Intronic
942675469 2:178422035-178422057 TATTCATTCTATCAGGGTAGAGG + Intergenic
942976148 2:182020722-182020744 TTTTCTTTCTCTTAAGATATGGG - Intronic
943195509 2:184742492-184742514 TATTCTTTCTATCAGGTGATAGG - Intronic
943471969 2:188305458-188305480 CATTCCTTCCTTTAGGGTATGGG + Intronic
946152135 2:217783120-217783142 TATTTTTTCTTTTAGGGGAGGGG + Intergenic
947067670 2:226247877-226247899 TATTCATTCTGTTTGCTTATAGG - Intergenic
948438942 2:237973477-237973499 TATTCTTTCTGCTAGCATTTTGG - Intronic
948536031 2:238647696-238647718 TATATTTTATGTTATGGTATAGG + Intergenic
1171240014 20:23559536-23559558 TATTTTATCTGATATGGTATAGG + Intergenic
1176780155 21:13183630-13183652 TATTCTTTCTGTTGAGCTACTGG - Intergenic
1177380894 21:20342970-20342992 TATTCTTTCTGGATGGGAATTGG + Intergenic
1180097749 21:45567399-45567421 TATTCTGTATGATAGTGTATTGG + Intergenic
1183454582 22:37915244-37915266 TATTTTTTCTGTTTAGGGATGGG - Intronic
951159653 3:19402303-19402325 TATTCTTCCTATTATGATATTGG - Intronic
951284698 3:20795110-20795132 CTTTCTTTCTGTTAGGGTTGAGG + Intergenic
952628749 3:35439609-35439631 TTTTCTTTCTCTTAAGGTCTAGG - Intergenic
952668257 3:35934619-35934641 TATTCTTCCTATGGGGGTATGGG + Intergenic
953446013 3:42967677-42967699 TATTTTTTCTATTAGCTTATAGG + Intronic
954772867 3:52988825-52988847 TATTCTGCCAGTTAGGGTTTTGG - Intronic
955279768 3:57583071-57583093 TATTCTTTGTTGTTGGGTATGGG - Intronic
955958561 3:64316097-64316119 CATTCCTTCTTCTAGGGTATGGG - Intronic
957065971 3:75522447-75522469 TATTCTCTTTGATAGGGTAAGGG - Intergenic
957499851 3:81040727-81040749 TTTTCTTTCAGTTTGGGTAGGGG - Intergenic
957812426 3:85242823-85242845 TATTCTTTCTGTTTTGGTTGTGG + Intronic
957831185 3:85522143-85522165 TTTACTTTCTGTTAGGTGATAGG + Intronic
958457425 3:94349007-94349029 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
959134568 3:102400772-102400794 TATTTTTTTTATTAGTGTATGGG - Intronic
960416765 3:117394375-117394397 TATTTTTTCTGTTTGGTTTTTGG + Intergenic
961147986 3:124611310-124611332 AATTCTTTCTGCTATGGTCTAGG - Intronic
961199320 3:125031499-125031521 TTCTCTTTCTGTTTGGGAATGGG + Intronic
963998997 3:151745493-151745515 TATTCTTTCTTTAAAGCTATAGG + Exonic
966207766 3:177422413-177422435 TATTCTTTGTGTAAAGTTATGGG + Intergenic
967139572 3:186543727-186543749 TATTCTTTCAGGTAGGGCTTTGG - Intronic
967646920 3:191936247-191936269 TATTCTTTCTGATACTGTAATGG - Intergenic
969629754 4:8329308-8329330 TAGTTTTTCAGTTAGGGCATGGG + Intergenic
971894108 4:32568682-32568704 TATTATTTCTTTTAAGGTATAGG - Intergenic
971996365 4:33970611-33970633 TATTATTTCTGTGTGTGTATAGG - Intergenic
974347643 4:60702244-60702266 TATTCTCTCCATTAGGCTATGGG + Intergenic
975928855 4:79493137-79493159 TATTTTTTCTTTTAGGGATTTGG + Intergenic
976050069 4:81001243-81001265 TATTCTTTTTCAAAGGGTATTGG - Intergenic
977803064 4:101262000-101262022 TATTTTTTTTGTTATTGTATAGG - Intronic
978332097 4:107624876-107624898 AAGTATTTCTGTTAGAGTATTGG - Intronic
979731924 4:124034390-124034412 TGTTCTATCTTTTAGTGTATAGG + Intergenic
981113822 4:140966681-140966703 TATTCTTTTGGTAAGGATATGGG + Intronic
982210795 4:153033989-153034011 TATTCTTTTTGTTAAGGAAAAGG + Intergenic
982636445 4:157903045-157903067 TATTCTTTCTGTGAGGGAGCAGG - Intergenic
982719179 4:158841554-158841576 TATTCTTTGTGTCAGGGAAAAGG + Intronic
982889874 4:160833455-160833477 TATTCTTTCTTTTAGGGGGCTGG - Intergenic
983197595 4:164824538-164824560 TATTCCTTTTCTTTGGGTATAGG + Intergenic
983945894 4:173585170-173585192 TACTCATGCTGTGAGGGTATGGG - Intergenic
984059766 4:174977520-174977542 TCTTCTTTCTCTTAGGGGGTGGG - Exonic
987339303 5:16925166-16925188 AATTATTTCTGTTTGGGTTTTGG - Intronic
988133845 5:27142328-27142350 CATTCTTTCTGTCTAGGTATAGG - Intergenic
988705253 5:33719845-33719867 TTTTCTTTGTATTAGGCTATGGG - Intronic
988754770 5:34236153-34236175 TATACTTTATATTAGGGCATGGG - Intergenic
989043994 5:37256757-37256779 TATTCTTTCAGTTACATTATGGG + Intergenic
990025071 5:51178148-51178170 TATTATTTCTATTAGAGTAAGGG + Intergenic
991279474 5:64895306-64895328 TTTTTTTTCTGTTAGGTTGTTGG - Intronic
991742984 5:69701845-69701867 TATACTTTATATTAGGGCATGGG - Intergenic
991754712 5:69853357-69853379 TATACTTTATATTAGGGCATGGG + Intergenic
991794557 5:70281582-70281604 TATACTTTATATTAGGGCATGGG - Intergenic
991822371 5:70577157-70577179 TATACTTTATATTAGGGCATGGG - Intergenic
991834039 5:70728506-70728528 TATACTTTATATTAGGGCATGGG + Intergenic
991886937 5:71281125-71281147 TATACTTTATATTAGGGCATGGG - Intergenic
995479739 5:112582259-112582281 TCTTAATTCTCTTAGGGTATTGG + Intergenic
995965105 5:117896498-117896520 TATTGTTTCTTTCAGGGAATTGG - Intergenic
996045811 5:118872671-118872693 TATTATTTCTGTTATGGTGGTGG - Intronic
999577505 5:152995851-152995873 GAATCTTTCTGTTAGGGAACTGG + Intergenic
999927804 5:156398096-156398118 TATTCTTTCTGCTTAGGCATTGG + Intronic
1002363604 5:178693340-178693362 TATTCTTTCTGGTGGGTTCTTGG + Intergenic
1002678700 5:180941570-180941592 TATTCTTTTTGATATGCTATTGG - Intronic
1005444135 6:25903645-25903667 AATTCTTTCTGTGAGGCAATGGG + Intergenic
1005553391 6:26947865-26947887 TATACTTTATATTAGGGCATGGG - Intergenic
1006321783 6:33323421-33323443 TTTTCTTTCAGTTGGGCTATTGG + Intronic
1008389810 6:50936961-50936983 TAAACGTTCTTTTAGGGTATGGG - Intergenic
1008451027 6:51650997-51651019 AATTCTTTCTGATAGGGGCTAGG + Intronic
1009337485 6:62510337-62510359 TTTGCTTTCTTTTATGGTATGGG - Intergenic
1009643363 6:66365735-66365757 TATTCTTGATCTTAGGGTGTAGG - Intergenic
1009924993 6:70109864-70109886 TTTCCTTTCTGATAGGCTATAGG + Intronic
1012381886 6:98630040-98630062 TTTTTTTTATGTTGGGGTATAGG - Intergenic
1012727699 6:102836724-102836746 TATTCTTACTGTTAGTTTCTTGG + Intergenic
1013527085 6:110984292-110984314 AATTCTTTGTATTAGGGTACAGG + Intronic
1015062988 6:128990220-128990242 TATTCTTTCTGTAATAGCATAGG - Intronic
1015426384 6:133073490-133073512 TATTCTATCTGTTAGAGAAGAGG + Intergenic
1016144507 6:140651554-140651576 TTTTGTTTCTTTTAGGGGATAGG - Intergenic
1020223168 7:6257288-6257310 TTTTGTTTGTGTTAGAGTATGGG - Intronic
1024265620 7:47604225-47604247 TATTCTTTCTGGTGGGTTCTTGG - Intergenic
1024347862 7:48331180-48331202 TATTCTTTCTTTTAAGATAGAGG - Intronic
1027276338 7:76560848-76560870 TTTTCTTGCTGATAGGTTATAGG - Intergenic
1028382399 7:90213163-90213185 TAGTCACTCTGTCAGGGTATGGG + Intronic
1030658728 7:112196342-112196364 TAGTTTTTCTGGCAGGGTATTGG - Intronic
1033188208 7:139250030-139250052 TATTTTTTTTGGTAGGGGATGGG - Intronic
1033946046 7:146718954-146718976 TCTACTTTCAGTTAGCGTATTGG - Intronic
1035119503 7:156554347-156554369 TATTTTTTCTTTTAGAATATAGG - Intergenic
1036519355 8:9475983-9476005 TATTCCTTCTTATAGGCTATTGG + Intergenic
1037373234 8:18202429-18202451 TATTCCTTCTGGTAGGTTCTTGG + Intronic
1037747390 8:21657884-21657906 TGTTCTTTTTTTTATGGTATTGG + Intergenic
1038318319 8:26506957-26506979 AATTCTTTCTTCTATGGTATGGG + Exonic
1039249560 8:35647519-35647541 TAGTCTTCATGTTAGGGAATAGG + Intronic
1039888739 8:41670632-41670654 TTCCCTTCCTGTTAGGGTATTGG + Intronic
1040853117 8:51922638-51922660 CATTCTTTCCCTTAGGGCATTGG - Intergenic
1043172712 8:76985697-76985719 TATTCTTTCTGTTAGGGTATTGG - Intronic
1044546298 8:93464161-93464183 TATTCTGTTTGTTAGTGTAATGG + Intergenic
1046309070 8:112410935-112410957 TATTCTTTCTCTTAGCTTTTTGG + Intronic
1046640614 8:116726320-116726342 TATTATTTATGTAAGGGTAAAGG - Intronic
1047130113 8:122009339-122009361 CTTTTTTTCTGTTAGGGGATGGG + Intergenic
1050726089 9:8650692-8650714 TATGATCTCTGTCAGGGTATTGG - Intronic
1050811106 9:9748983-9749005 TATTGGTTCTGTTAGCCTATTGG - Intronic
1052655936 9:31360484-31360506 TAATTTCTCTCTTAGGGTATTGG + Intergenic
1055241745 9:74194639-74194661 TATTCCTTCTGGTAGGTTCTTGG + Intergenic
1055624365 9:78159581-78159603 TTTTCTTGCTGATAGGTTATTGG + Intergenic
1058487930 9:105460859-105460881 TGTTTCTTCTGTTATGGTATTGG + Intronic
1059126674 9:111694371-111694393 TATTTTTTATGTTAGATTATAGG + Intronic
1185802245 X:3022751-3022773 TATTCTTGCTGTTTGGGTTATGG - Intronic
1186538687 X:10376685-10376707 TATTCTTTTAGTTAGGATTTCGG + Intergenic
1187036360 X:15544480-15544502 TATTCTTGCTTTTAGAGTAAAGG - Intronic
1187728275 X:22226428-22226450 TTTTCTTTCTGTTAGGTCAAGGG + Exonic
1189121043 X:38395269-38395291 TCTTCTTTCAGTTAGGACATTGG + Intronic
1189651049 X:43189697-43189719 TATTTTCTCTTTTAGGGCATAGG + Intergenic
1191986821 X:66990023-66990045 TTTTATTTCTGTTTGGTTATTGG + Intergenic
1193588507 X:83357835-83357857 TATTCTTTTATTTAGGGAATTGG + Intergenic
1194246929 X:91525427-91525449 TATTCATTCTGATAGGGGAGGGG - Intergenic
1195717445 X:107830342-107830364 TATCCTTGCTGTTAGGCCATGGG + Intronic
1196365382 X:114917609-114917631 TATTATTTTTGTTAGTGTACTGG + Intergenic
1196536830 X:116855815-116855837 TATTCTTTCTCTTAGAGTAATGG + Intergenic
1197929416 X:131679344-131679366 TATTCTTTTTATTAAGTTATGGG + Intergenic
1198743088 X:139861980-139862002 CATTCCTTCCCTTAGGGTATGGG - Intronic
1200773671 Y:7150715-7150737 TATTCCTTCTGATAGTTTATTGG + Intergenic
1201855458 Y:18535883-18535905 TAGTTTTTCAGTTAGGGTTTGGG + Intergenic
1201877863 Y:18784502-18784524 TAGTTTTTCAGTTAGGGTTTGGG - Intronic