ID: 1043172713

View in Genome Browser
Species Human (GRCh38)
Location 8:76985703-76985725
Sequence AGTAACTATTCTTTCTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043172713_1043172719 0 Left 1043172713 8:76985703-76985725 CCCTAACAGAAAGAATAGTTACT 0: 1
1: 0
2: 0
3: 30
4: 236
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172713_1043172722 20 Left 1043172713 8:76985703-76985725 CCCTAACAGAAAGAATAGTTACT 0: 1
1: 0
2: 0
3: 30
4: 236
Right 1043172722 8:76985746-76985768 TGGAGCTCACTGCCACGGTCTGG No data
1043172713_1043172721 15 Left 1043172713 8:76985703-76985725 CCCTAACAGAAAGAATAGTTACT 0: 1
1: 0
2: 0
3: 30
4: 236
Right 1043172721 8:76985741-76985763 CCTGCTGGAGCTCACTGCCACGG No data
1043172713_1043172718 -10 Left 1043172713 8:76985703-76985725 CCCTAACAGAAAGAATAGTTACT 0: 1
1: 0
2: 0
3: 30
4: 236
Right 1043172718 8:76985716-76985738 AATAGTTACTGAGGGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043172713 Original CRISPR AGTAACTATTCTTTCTGTTA GGG (reversed) Intronic
901008697 1:6185340-6185362 AGAAACTCTGCTTTCTGTGACGG + Exonic
909088477 1:71195910-71195932 CATTACTATTCTATCTGTTATGG - Intergenic
910933478 1:92465478-92465500 TGTAATTTTCCTTTCTGTTAAGG - Intergenic
911952778 1:104196936-104196958 AGGAACTGATCTCTCTGTTATGG - Intergenic
912309002 1:108600079-108600101 GGTAGCTGTTCTTGCTGTTATGG + Intronic
912743073 1:112219952-112219974 AGTAACTATTCCTGTTGGTAAGG - Intergenic
913052106 1:115126580-115126602 CGTAACCATTCTTTCTCTTCTGG + Intergenic
915547308 1:156607921-156607943 ATTCACTTTTCTTTCTGTTGAGG + Intergenic
918525353 1:185458471-185458493 AGAAATTATGCTTTGTGTTAGGG - Intergenic
918534621 1:185560448-185560470 AGTGACTATTATTTCTATTATGG + Intergenic
919155433 1:193759123-193759145 TGTATCTATTTTTTCTGTAATGG - Intergenic
919267547 1:195290467-195290489 AATCACTGTTCTTTCTGTTCAGG + Intergenic
921658541 1:217770418-217770440 AGAAATTGTTATTTCTGTTATGG + Intronic
923813970 1:237353651-237353673 AATAACTGTTGTTTCTTTTAAGG + Intronic
924123478 1:240826254-240826276 AGTACCTTTTCTTTCTTTTAAGG - Intronic
1062917369 10:1251556-1251578 AAAAACCATTCTTTGTGTTAGGG - Intronic
1063694619 10:8321460-8321482 AGTAACTGTTTTTTATGATATGG - Intergenic
1066172486 10:32865485-32865507 AGTAACTCTTATTGCTGGTAAGG + Intronic
1068904755 10:62310263-62310285 AGTAATTATTGTTACTATTATGG - Intergenic
1069318015 10:67131952-67131974 AGTTTCCATTCTTTCTGTAATGG - Intronic
1070498347 10:77046173-77046195 AGTAAATATTCTTCCTATAAAGG + Intronic
1072307502 10:94121623-94121645 AGTAACTAGTGTTTCTTTAATGG - Intronic
1074084685 10:110200233-110200255 AATAATTATTATATCTGTTATGG - Intergenic
1075543260 10:123333892-123333914 AGGAACTGTTCTTGCTGTTAGGG + Intergenic
1076123696 10:127957089-127957111 TGTATCAATTCTTTCTTTTATGG + Intronic
1076447838 10:130530473-130530495 TGAAACTATTTTTTTTGTTAGGG + Intergenic
1077966119 11:7135345-7135367 ACTGATGATTCTTTCTGTTATGG + Intergenic
1079502253 11:21114658-21114680 AGTTACTATTCTTTGGGTGAAGG + Intronic
1079699572 11:23527123-23527145 AGAAAATCTTCTTTCTCTTAAGG - Intergenic
1079872424 11:25816289-25816311 AGGAACTTCTCTTTCTGCTAGGG - Intergenic
1080111406 11:28572141-28572163 AGGAGCCATTCTTTCTCTTAAGG + Intergenic
1080139456 11:28898523-28898545 ACTGACTATACTTTATGTTATGG + Intergenic
1080909897 11:36585667-36585689 AGAAACTTTCCTTTCTTTTAAGG + Intronic
1084855856 11:71985740-71985762 AGCCACTATTCTATCTGTGATGG - Intronic
1086485866 11:87300950-87300972 AGAAACTGTTCTATCTGTTCTGG + Intronic
1087265995 11:96061811-96061833 CTTAATTTTTCTTTCTGTTAGGG + Intronic
1088028129 11:105211618-105211640 ACTTACTATTCTTTGTGTCAAGG + Intergenic
1088840171 11:113620445-113620467 TGCTACTATTCTTTCCGTTAAGG + Intergenic
1089799968 11:121019471-121019493 AGTAGCTATGATTTTTGTTATGG + Intergenic
1089875127 11:121713984-121714006 ATCACCTATTCTTTCTGTGAGGG + Intergenic
1090318968 11:125824251-125824273 ACTTAATATTCATTCTGTTATGG - Intergenic
1090531291 11:127593517-127593539 TGTAACTATTGTGTCTGGTACGG + Intergenic
1092486168 12:8903742-8903764 AGTCACTTTTTTTTCTGTCATGG - Intergenic
1093649971 12:21631809-21631831 AGTAACTCTTCTAGTTGTTATGG - Intergenic
1093721409 12:22446608-22446630 AATATCTATACTTTTTGTTATGG - Intergenic
1096275906 12:50208009-50208031 AGAAACTATTCTTACTGGTGTGG - Intronic
1097625022 12:61989548-61989570 AGTAACCATTCTTTCTGAATGGG - Intronic
1098071257 12:66677487-66677509 AGAGACTATCCTTTCTGTTACGG - Intronic
1099082688 12:78205857-78205879 AGTATCTTTTCTTTCTGTACTGG - Intronic
1103060209 12:117852555-117852577 AATAACTATTCTTTCCCATAAGG + Intronic
1103429385 12:120869430-120869452 AATAACTATTCTGTCTCATATGG - Intronic
1107250555 13:38355705-38355727 AGTAAATATACTTTCTCTTATGG - Intronic
1109107260 13:58269334-58269356 AGTAACTTTTGCTTCCGTTAGGG - Intergenic
1109505216 13:63291813-63291835 AGTAATTATTGTTTATCTTAAGG - Intergenic
1109525594 13:63570843-63570865 ATTTACTATTCTTTTTATTATGG - Intergenic
1109822110 13:67670249-67670271 AATTATTATTATTTCTGTTATGG + Intergenic
1112776937 13:102854541-102854563 ATTTACTATTCTTTGTGTTTTGG + Intronic
1114187974 14:20417704-20417726 AGTAACTATCGCTTCTGTTTAGG - Intergenic
1115019291 14:28655746-28655768 CCTAACTATTCTTTGTGTTTAGG + Intergenic
1116634281 14:47375536-47375558 AGTTAATATTCTTTTTTTTAAGG - Intronic
1116801562 14:49449630-49449652 GGTAAATATTCATGCTGTTAGGG - Intergenic
1117759134 14:59008048-59008070 AGTACCTATTCTTGCTTTTTAGG - Intergenic
1117888385 14:60390091-60390113 TGTATCTATTTTTTCTGTTATGG - Intergenic
1118144878 14:63124458-63124480 AAGACCTATTCTTTCTGTTATGG - Intergenic
1118445718 14:65849587-65849609 AATAACTGTTCTGCCTGTTAGGG + Intergenic
1119163021 14:72469136-72469158 AATGACTTTTCTTTCTGTTTTGG + Intronic
1120164121 14:81176451-81176473 AGTAACTACTCTTTCAGTCAAGG - Exonic
1120573641 14:86153200-86153222 AGTTAATATTATTTCTGCTATGG + Intergenic
1120573645 14:86153270-86153292 AGTTAATATTATTTCTGCTATGG + Intergenic
1123789628 15:23708002-23708024 AGAAAATATTCTATCTTTTAGGG - Intergenic
1126363567 15:47870931-47870953 AGTTACAATTTTATCTGTTAGGG - Intergenic
1126450222 15:48799955-48799977 AGAAAATATTCTTTCTGTTCAGG - Intronic
1126454077 15:48842317-48842339 AGTGGCTACTGTTTCTGTTAGGG - Intronic
1126980156 15:54232550-54232572 AGTAACCATTATTTCTTTTATGG - Intronic
1130743265 15:86624017-86624039 AATCTCTATTCTTTCTCTTATGG - Intronic
1130965230 15:88692673-88692695 TGTATCTTTTTTTTCTGTTAGGG - Intergenic
1137895644 16:52208928-52208950 ACTAACTAATCTTTCTCTCAAGG + Intergenic
1139231464 16:65286969-65286991 AGTATTTATTATTTCTGTTTTGG + Intergenic
1139755628 16:69141000-69141022 AGTAAATTTTCTTTCTTTTCCGG + Intronic
1140249437 16:73282934-73282956 AGGCACTATTCTTAATGTTAGGG + Intergenic
1144247978 17:13386573-13386595 AGTTACTTTTCTTTCTTTTTAGG - Intergenic
1146613252 17:34327330-34327352 AGTAACTGATCTTACTGTCAAGG + Intergenic
1147808296 17:43148046-43148068 AGTAACTATTTTTCCTGTCTTGG + Intergenic
1148357645 17:46986399-46986421 AGTAACTATTATTTATAATAAGG + Intronic
1149121786 17:53177083-53177105 AGGGACTATTCTTTCTGTCTCGG - Intergenic
1149422751 17:56527183-56527205 TGCAATTATTTTTTCTGTTAAGG - Intergenic
1149549465 17:57529561-57529583 AGCAACTATTACTTCTGTAATGG + Intronic
1150172716 17:63016659-63016681 ACTTAATATTCTTTCTGTCATGG + Intronic
1150518588 17:65841656-65841678 TTTATCTTTTCTTTCTGTTAAGG - Intronic
1153135541 18:1913227-1913249 ATTATCTATTCTTTTTTTTAAGG - Intergenic
1153769354 18:8402612-8402634 AGGGACAATTCTTTCTGTAATGG - Intronic
1155299247 18:24413620-24413642 AGTAAATAATGTATCTGTTAGGG - Intergenic
1155689252 18:28597676-28597698 TGTAACTATTCATTTTGTTGTGG + Intergenic
1155812161 18:30250517-30250539 AGCAATTATTCTTTTTGTTGAGG + Intergenic
1155997511 18:32345859-32345881 AGTAAATATGCTTTCTATTAAGG + Intronic
1157633497 18:49125307-49125329 GGAAACTATTCTTTCTGTATAGG - Intronic
1158462405 18:57658006-57658028 AGGAAATATTCTTTTTGTTAAGG - Intronic
1159156859 18:64594939-64594961 AGTAAATAATTTTGCTGTTACGG + Intergenic
1159467024 18:68796950-68796972 AGGTACCATTCTTTCTGTCATGG - Intronic
1159700540 18:71621248-71621270 AATTACTATTATATCTGTTATGG - Intergenic
925715363 2:6779961-6779983 GGTCACTATTCTTTATGTCATGG + Intergenic
926820138 2:16843016-16843038 AAGAGCTATTCTTTCTTTTAGGG + Intergenic
927247906 2:20972765-20972787 AGTAACTGTTTTTTCTGGTGTGG + Intergenic
928504236 2:31933063-31933085 AATAACTATACTTTTTTTTAAGG + Intronic
928975845 2:37085596-37085618 AGTCACTATTCTGTTTTTTATGG - Intronic
931309488 2:61065137-61065159 AGTAATTATTCATTTGGTTAAGG + Intergenic
931375591 2:61704950-61704972 AGTCATTATTCTGTCTGTTGTGG + Intergenic
931936179 2:67199428-67199450 AGAATTTATTCTTTCTGTTTTGG - Intergenic
936043386 2:109167121-109167143 AGTAAGTGTTCTTTATGATATGG + Intronic
937695239 2:124801629-124801651 ATTAATATTTCTTTCTGTTAAGG + Intronic
939738262 2:145876870-145876892 AGAAACAATTCTTGCTGTCAAGG + Intergenic
939746716 2:145980983-145981005 AGTATATATTCTTTCTGCTCTGG + Intergenic
940500471 2:154487566-154487588 AGTAACTTCACTTTCTGATATGG + Intergenic
940511419 2:154620137-154620159 ACTAACTATTCTTTTTTTTGGGG - Intergenic
940837252 2:158536781-158536803 AGCAAAGATTCTTTCTGTCAAGG - Intronic
942387053 2:175453338-175453360 AGAAAATATTCTTTCTGCTATGG - Intergenic
944139734 2:196442955-196442977 AGTAAATTTCCTTTCTGTTTCGG - Intronic
1171313996 20:24170169-24170191 TGTAACAATTCTTACTCTTATGG + Intergenic
1175584676 20:60128725-60128747 TGTATCCATTCTTTCTTTTATGG - Intergenic
1176174828 20:63715727-63715749 AGGAAGTATTCTTTATATTATGG + Intronic
1176934786 21:14854042-14854064 GGTAACTCTTTTTTATGTTAAGG - Intergenic
1176952071 21:15060122-15060144 ACTAACTTTTCTCACTGTTATGG - Intronic
1177945103 21:27457849-27457871 AGTAACTTTTATTTCTCTTTTGG + Intergenic
1179383841 21:40923867-40923889 AGTAAATATGTTTCCTGTTAGGG + Intergenic
1182227565 22:28811202-28811224 GGTAACTATTCTTTATGCTGAGG + Intergenic
949917787 3:8977874-8977896 AGTAAGTATTCTCAATGTTAGGG + Intergenic
950350833 3:12350388-12350410 AGTAACTATTCATTCTTCAAGGG - Intronic
950937458 3:16854546-16854568 ATTATCTATTTTTTCTTTTATGG + Intronic
951049988 3:18083570-18083592 AATAAATATTATTTCTGATATGG - Intronic
951418949 3:22461087-22461109 AGTAAATATTCTCTGTTTTATGG + Intergenic
951999494 3:28769749-28769771 ATTAACTATTCTGTGTTTTAAGG - Intergenic
952137037 3:30434209-30434231 AGTAATTAATCTTTCTCTGAAGG + Intergenic
956807630 3:72832492-72832514 AGCAATTATTCTTTCTTTTCTGG - Intronic
957063100 3:75498244-75498266 AGTAACTTTTTTTTTTGTTGGGG - Intergenic
957409224 3:79816203-79816225 TGAAACTGTTCTGTCTGTTATGG + Intergenic
957657375 3:83097877-83097899 AGTAAATATTCTTTTTTTTTAGG + Intergenic
957863030 3:85982841-85982863 TGAAAATATTCTTTCTGTTTAGG - Intronic
963723134 3:148887113-148887135 AGTAATTTTTTTTTCTGTAAAGG + Intronic
963946526 3:151151748-151151770 AGTTATTATTATGTCTGTTATGG - Intronic
964079290 3:152732059-152732081 AGCATTCATTCTTTCTGTTAGGG - Intergenic
964248347 3:154681540-154681562 TGTCACTAATATTTCTGTTATGG - Intergenic
964562076 3:158008990-158009012 AGTAAATATTCTTGCTTTTTAGG + Intergenic
964824585 3:160811011-160811033 AGTTTCTATTCATTATGTTATGG + Intronic
966382497 3:179357520-179357542 AAGAACTTTTCTTTATGTTATGG - Intronic
967281171 3:187825390-187825412 AGTAACTACTCTTCCTTTCATGG + Intergenic
968635871 4:1678998-1679020 CATAACAATTCTTTCTTTTATGG - Intronic
971858578 4:32075523-32075545 AGTAACTATTCTATCTTGTATGG + Intergenic
972074740 4:35072593-35072615 AGTAATTGTTCTTTCTTATATGG + Intergenic
973055083 4:45646829-45646851 ATTGACTCTTCTTTGTGTTAGGG - Intergenic
974895342 4:67931489-67931511 AATAAATTTTCTTTCTGTCATGG - Intronic
975746695 4:77481983-77482005 AGTCACTAGTCTTTCTGGAATGG - Intergenic
976798499 4:88960844-88960866 AGTAACTGTTGCTTTTGTTAGGG - Intronic
976903816 4:90211107-90211129 AGTAACTTTTCTTTCAATTTTGG + Intronic
977362052 4:96017663-96017685 TGTAACTATTCTTTCACTTTAGG + Intergenic
977406977 4:96612137-96612159 TGTAACTATTATTCCTATTAAGG - Intergenic
977639930 4:99345952-99345974 ATTATCTATTTTTACTGTTATGG + Intronic
977844320 4:101750460-101750482 AGTAAGTATTCTTCCATTTATGG + Intronic
977980696 4:103317945-103317967 TGTATCTTTTCTTTCTTTTAAGG + Intergenic
978525432 4:109660186-109660208 AATAACTGTTATTTCTGTTAAGG - Exonic
978605043 4:110470757-110470779 ATTCACTATTATTTCTTTTAAGG + Intronic
978871499 4:113583783-113583805 TGTAATTTTTTTTTCTGTTATGG + Intronic
978973621 4:114841609-114841631 AGTGACCATGCTTTCTGCTAGGG + Intronic
979172474 4:117619630-117619652 ATTAATTATTCTTTCTGTCAGGG - Intergenic
979286113 4:118926512-118926534 ATTAAATATTCTTTCTGCCATGG + Intronic
981923151 4:150109074-150109096 AATAAATATTATTTATGTTATGG - Intronic
982008921 4:151088327-151088349 AGTAGCTATTTTTTTTTTTAAGG + Intergenic
982196878 4:152925174-152925196 AGTCTCTATTTTTTCTGATAAGG + Intergenic
982210433 4:153030410-153030432 TGTATCTTTTCTTTCTGCTAAGG - Intergenic
982465980 4:155732805-155732827 AGGAGCTATTCTTTCTGTTCTGG + Intergenic
982514833 4:156332190-156332212 AGAAATGATTCTTCCTGTTATGG + Intergenic
982663387 4:158231528-158231550 GGTAACTATTCTTAGTGTTGTGG + Intronic
982670523 4:158314609-158314631 AGTAACTATTTTCTCTATTCTGG + Intergenic
982889877 4:160833461-160833483 AGGACTTATTCTTTCTTTTAGGG - Intergenic
983139919 4:164137282-164137304 AGTAACAAGGCTGTCTGTTAAGG - Intronic
983657785 4:170100261-170100283 AGAAACAATTCTTTGAGTTAGGG + Intergenic
986523880 5:8651569-8651591 GGTAATTATTCTATCTCTTATGG + Intergenic
989006507 5:36820119-36820141 ATTAACTTTTTTTTCTCTTATGG - Intergenic
991964042 5:72073624-72073646 AGTACCTATTGTTTCTTTCAAGG - Intergenic
992839509 5:80673943-80673965 TGAAAGTATTATTTCTGTTATGG + Intronic
993081756 5:83309896-83309918 AAAAACTAATCTTTATGTTATGG + Intronic
993281386 5:85929112-85929134 AATAACTTTTCTTTTTGTTATGG - Intergenic
993998167 5:94747195-94747217 AGCAAGTATTTTTTCTGTAATGG + Intronic
993998181 5:94747424-94747446 AGTAATTTTTTTTTCTGTAAAGG + Intronic
994115623 5:96058831-96058853 AGTAACTTTAATTTCTGTTAAGG - Intergenic
994280423 5:97895557-97895579 AATAAATATTCTATCTGCTAAGG + Intergenic
996936032 5:128949773-128949795 ATTAAGTATTTTTTCTTTTATGG - Intronic
997394775 5:133550300-133550322 AGTATCTACTCTTTCTGAAATGG + Intronic
998612887 5:143708528-143708550 ATTAAAAATACTTTCTGTTAAGG + Intergenic
1001700016 5:173700032-173700054 AGTTACTATTATTGCTGTTGTGG - Intergenic
1002822747 6:742347-742369 AATTATTATTATTTCTGTTATGG - Intergenic
1004735295 6:18399928-18399950 AATAAATAGTCTTTCTGTTAAGG + Intronic
1006618838 6:35348327-35348349 AGAAACAATTCTGTGTGTTATGG - Intronic
1008309165 6:49944060-49944082 ATTAGCTATTTTTTCTGATATGG + Intergenic
1009279625 6:61731071-61731093 AGTAACTACACTTTCTATCAAGG + Intronic
1009326735 6:62359688-62359710 AGTATCTATTTTTACTGATAGGG - Intergenic
1010877636 6:81127573-81127595 AATTTCTATTCTTTCTGTTCTGG + Intergenic
1011558207 6:88590273-88590295 AGGAACTATTCTTGCTCTTAAGG + Intergenic
1012153089 6:95780667-95780689 ATTAACACTTGTTTCTGTTAAGG + Intergenic
1012163687 6:95921943-95921965 AATAGCTATTCTTCCTATTATGG + Intergenic
1012386763 6:98691640-98691662 ATTAACTATTGTTGTTGTTAGGG - Intergenic
1013138637 6:107308426-107308448 AGTATGTATTCTTTCTCTTAAGG + Intronic
1014929118 6:127312082-127312104 AGAAAGTATTCTTTCTCCTAAGG + Intronic
1016163754 6:140913723-140913745 TGTAACAATTCTTACTGTTCTGG - Intergenic
1016473656 6:144402466-144402488 AGTAACTTTTCTTTTTTTTATGG + Intronic
1017482531 6:154871767-154871789 AGTAATTATTCTTTTTTTTGTGG - Intronic
1017562860 6:155648912-155648934 AGCATATATTCGTTCTGTTATGG - Intergenic
1018626721 6:165786504-165786526 AATAAGTCTTCTTTCTGTGAAGG - Intronic
1019003273 6:168773780-168773802 AGTAACTTTTTTTTGTTTTAAGG + Intergenic
1022065205 7:26848113-26848135 ATTAGCCATTCTTTCTGATATGG + Intronic
1022144921 7:27527711-27527733 CATTACTATTATTTCTGTTACGG + Intronic
1022573297 7:31474189-31474211 AGTAACACCTCTTGCTGTTAGGG + Intergenic
1022681657 7:32553634-32553656 TTTAACCTTTCTTTCTGTTAAGG + Intronic
1024396300 7:48872061-48872083 AATAATTATTTTTTCAGTTATGG + Intergenic
1027854838 7:83498066-83498088 AGTAAATATATTTTCTCTTATGG + Intronic
1029276413 7:99407862-99407884 AGTAACTATTCTTATTTTTAAGG - Intronic
1029885588 7:103867339-103867361 ATGAACTAATCTTTCTCTTAGGG - Intronic
1031933272 7:127708557-127708579 AGTTTCTCTTCTTTCTGTTTTGG + Intronic
1032108172 7:129052367-129052389 AGTAACTATTCCCTCTTTTATGG + Intronic
1033944858 7:146704372-146704394 AGTATCTATTTTGTCTGTTCTGG - Intronic
1038133815 8:24764416-24764438 ACTTACTATTTTTTCTATTAGGG + Intergenic
1040418323 8:47216168-47216190 AATAAATTTTCTTTCAGTTATGG + Intergenic
1040506036 8:48049043-48049065 ATTAACTCTTCTTTCTGCTATGG - Intronic
1040517539 8:48146988-48147010 TGTAACTTTTCTTTTTGTCATGG + Intergenic
1041158768 8:55015598-55015620 AGCAAATATTCTTTCATTTATGG - Intergenic
1043172713 8:76985703-76985725 AGTAACTATTCTTTCTGTTAGGG - Intronic
1044237751 8:89851543-89851565 AGTAACTATTGTCTCTGGGAAGG + Intergenic
1045232953 8:100322947-100322969 AGTTATTATTATATCTGTTATGG - Intronic
1045869522 8:106908945-106908967 AGTTGCTATTCTTTCAGTTATGG + Intergenic
1046054642 8:109064613-109064635 AATAACTATTCTTGTTGTTTAGG - Intergenic
1046442669 8:114279153-114279175 TTTAAGTATTCTTTCTTTTAAGG + Intergenic
1046918082 8:119698809-119698831 AGTAACTAGTGCTTTTGTTAGGG + Intergenic
1047703611 8:127474750-127474772 TGTTATTATTCTATCTGTTATGG + Intergenic
1047827197 8:128589989-128590011 ACTTCCTATTCTTTCTGTCAAGG + Intergenic
1047827860 8:128597321-128597343 AGTTATTATTATATCTGTTATGG + Intergenic
1048812887 8:138304473-138304495 AGTAACTATTAATTCTGACAGGG + Intronic
1050014253 9:1217048-1217070 AGTACCTGTGCTTGCTGTTAAGG + Intergenic
1050921281 9:11203999-11204021 AGTAACTATACTTACTGTCTTGG + Intergenic
1051398275 9:16651006-16651028 AGTTACTATCCTTTCTGGTGAGG - Intronic
1051426180 9:16933953-16933975 TGTAACTATTCTGTCTTTTTTGG - Intergenic
1052146370 9:25054500-25054522 AGTCATTATTCTTAGTGTTATGG - Intergenic
1052432882 9:28390009-28390031 AGTAACTATTATTGGTGTAATGG - Intronic
1053226362 9:36361761-36361783 AGTAGCTTTTGTTTCTTTTATGG - Intronic
1055884684 9:81047170-81047192 AATAAATATTCTTTCTGAGAAGG + Intergenic
1056025925 9:82495565-82495587 AGTAACTGTTATTTCTCTTCTGG + Intergenic
1056359940 9:85845820-85845842 AGTAATTATTATTACGGTTAAGG + Intergenic
1057530262 9:95838754-95838776 ATTAACTAGGCTTTCTGTTAGGG + Intergenic
1058339015 9:103871296-103871318 AGTAACTTTTATTTCTATAAAGG + Intergenic
1185970067 X:4652815-4652837 AATAAATATTCTTTCTGGAAGGG - Intergenic
1187886741 X:23895744-23895766 ATAAACTTTTCTTTCTGTTGTGG + Intronic
1188338154 X:28964428-28964450 ATTAACCATTCATTTTGTTATGG + Intronic
1188863924 X:35291017-35291039 ACTAACTCTTCTTTCAGTTTGGG + Intergenic
1190836707 X:54107850-54107872 AGTCACTAATCTTAATGTTAAGG + Intronic
1191653387 X:63566628-63566650 AATAACTTTTCTTTCAGTTATGG - Intergenic
1193469820 X:81887024-81887046 AGTGACTGTTATTTCTCTTATGG + Intergenic
1194743093 X:97598646-97598668 AATAATTATTCTTCCTGTGATGG + Intronic
1195504314 X:105639649-105639671 AGTGACGATTATTTCTGTAAAGG - Intronic
1196144309 X:112299812-112299834 AGTAACTTTTCAATCTGTTAGGG - Intergenic
1196235959 X:113280061-113280083 AGGAACTTTTCTTTGTGTGAAGG + Intergenic
1196506040 X:116443366-116443388 AGTAACAATTGTTTCAGTTGAGG - Intronic
1196866563 X:120076431-120076453 ATTAACGATTTTTTTTGTTATGG - Intronic
1196876536 X:120159850-120159872 ATTAACGATTTTTTTTGTTATGG + Intronic
1196907968 X:120457023-120457045 AGTAACCATTCTTTTGGTAAGGG - Intronic
1197778211 X:130134330-130134352 ATTAAATATCCTGTCTGTTAAGG - Intronic
1202080669 Y:21080875-21080897 TGTAACTCTTCTCTCTGATATGG + Intergenic
1202246118 Y:22822120-22822142 TGTAACTCTTCTCTCTGTAATGG + Intergenic
1202399106 Y:24455868-24455890 TGTAACTCTTCTCTCTGTAATGG + Intergenic
1202471674 Y:25214218-25214240 TGTAACTCTTCTCTCTGTAATGG - Intergenic