ID: 1043172714

View in Genome Browser
Species Human (GRCh38)
Location 8:76985704-76985726
Sequence CAGTAACTATTCTTTCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043172714_1043172721 14 Left 1043172714 8:76985704-76985726 CCTAACAGAAAGAATAGTTACTG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1043172721 8:76985741-76985763 CCTGCTGGAGCTCACTGCCACGG No data
1043172714_1043172719 -1 Left 1043172714 8:76985704-76985726 CCTAACAGAAAGAATAGTTACTG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172714_1043172722 19 Left 1043172714 8:76985704-76985726 CCTAACAGAAAGAATAGTTACTG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1043172722 8:76985746-76985768 TGGAGCTCACTGCCACGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043172714 Original CRISPR CAGTAACTATTCTTTCTGTT AGG (reversed) Intronic
901036023 1:6336739-6336761 CAGGCACTGTTCTTGCTGTTGGG + Intronic
902218527 1:14950009-14950031 CAGTAACTGTTTTTTCCGTTAGG - Intronic
903467865 1:23564840-23564862 CAGTAACTATTCCTGTTTTTAGG + Intergenic
904247118 1:29195665-29195687 CAGAGTCTATTCTCTCTGTTTGG + Intronic
904525943 1:31133984-31134006 CAGGCACTATTCTGTGTGTTGGG - Intergenic
906217078 1:44048624-44048646 TAGAAAATATTCTTTATGTTTGG + Intergenic
906845618 1:49188395-49188417 CAGTAAATATTCTGTCTAGTGGG - Intronic
910785374 1:90992040-90992062 CAGTATGTACTCTTTTTGTTTGG - Intronic
911546408 1:99222953-99222975 CAATGTCTGTTCTTTCTGTTTGG + Intergenic
912137300 1:106677116-106677138 CAGTGATTATCATTTCTGTTTGG - Intergenic
913242601 1:116842491-116842513 CAGTTATTATTCTTTTTGATTGG - Intergenic
916459031 1:165002729-165002751 CAGTTATTTTTGTTTCTGTTTGG - Intergenic
917185401 1:172348635-172348657 CACTAACTTTTCTTTTTATTGGG - Intronic
918336760 1:183523145-183523167 CAGTGATTATACTTTCTTTTTGG - Intronic
921366538 1:214379801-214379823 CAGTCAATATTGTTTCTGTCTGG - Intronic
921378636 1:214501237-214501259 GAGTAAGTATTCTTTTTTTTTGG + Intronic
922004338 1:221514052-221514074 CAGTAACTTTCATTTCTGTCTGG + Intergenic
923197023 1:231678328-231678350 CAGGAACTCTTCTGTCTGCTCGG + Intronic
923332369 1:232936939-232936961 CATTTGCTATTCCTTCTGTTGGG + Intergenic
924203647 1:241687704-241687726 CATTAACTATTCCATTTGTTTGG + Intronic
1062917370 10:1251557-1251579 CAAAAACCATTCTTTGTGTTAGG - Intronic
1063049032 10:2425785-2425807 CAGTGACTATTTTTGGTGTTAGG - Intergenic
1063740888 10:8817924-8817946 CAGTAAATATTCTGTTTATTGGG + Intergenic
1064881349 10:20057960-20057982 TTGTAACTATTCTTTCATTTGGG + Intronic
1064979603 10:21152737-21152759 CAGTAATTTAACTTTCTGTTTGG + Intronic
1065257232 10:23882932-23882954 GAGCAACTATTCATTCTGGTGGG + Intronic
1066394772 10:35008818-35008840 AAGTAATTATTGTTTTTGTTAGG + Exonic
1068578283 10:58709037-58709059 CATTTATTATTCTTTGTGTTGGG + Intronic
1069974689 10:72203327-72203349 TAGTAACTATGTTTTCTGTGGGG - Intronic
1071517100 10:86305443-86305465 CAGTAACAACTCTTTCTTTTGGG - Intronic
1073237680 10:102032352-102032374 AAGAAACTGTTCTTTATGTTAGG - Intronic
1074133170 10:110602054-110602076 TATTAACTTTTCTTTCTGCTCGG - Exonic
1075543259 10:123333891-123333913 CAGGAACTGTTCTTGCTGTTAGG + Intergenic
1075610398 10:123850028-123850050 CTGTAACTACTCTTTTTGTCTGG + Intronic
1076213843 10:128676575-128676597 CAGTAAATGATCTTTCTTTTCGG - Intergenic
1076447837 10:130530472-130530494 CTGAAACTATTTTTTTTGTTAGG + Intergenic
1076928541 10:133509289-133509311 CAGTAATTTTTTTTTCTTTTAGG - Intergenic
1077534201 11:3111813-3111835 CAGTCATTACTCTTTCAGTTTGG - Intronic
1078887813 11:15522820-15522842 CACTTACTGTTCTTTCTGTCTGG + Intergenic
1079319231 11:19437701-19437723 CAGTAACTTTTTTTTCTGAGTGG - Intronic
1079977666 11:27112031-27112053 CAGTGTCTATTCTTTCTCTTTGG - Intronic
1080432144 11:32209124-32209146 CAGTAGCCATTCTTTCCTTTAGG + Intergenic
1081372487 11:42321218-42321240 CAATCTCTATTCTTTCTCTTAGG - Intergenic
1081741074 11:45441027-45441049 TAGTAACTATTCTTTCAGGAGGG + Intergenic
1082585050 11:54926879-54926901 CAGTAAGTTTTATTTCTGTGAGG + Intergenic
1085015086 11:73168811-73168833 CAGTAACTGCTCTGTCTTTTTGG + Intergenic
1086476385 11:87179392-87179414 CATTAATTTTTTTTTCTGTTAGG + Intronic
1087414422 11:97835306-97835328 CATTTACTTTTTTTTCTGTTTGG - Intergenic
1087442329 11:98202224-98202246 CAGTAGCTGTTATTTCTGTAGGG - Intergenic
1088560473 11:111110459-111110481 CAGCAACTAGTCTTTCTAATTGG + Intergenic
1089875126 11:121713983-121714005 CATCACCTATTCTTTCTGTGAGG + Intergenic
1089962442 11:122627799-122627821 CTGTAACAATTCTACCTGTTGGG + Intergenic
1091252907 11:134158659-134158681 GAGTATCTTTTCTTTGTGTTGGG + Intronic
1092510528 12:9151065-9151087 AACGAAGTATTCTTTCTGTTTGG + Intronic
1092645130 12:10562621-10562643 CAGAAAGCATTCTTGCTGTTTGG + Intergenic
1093259736 12:16920653-16920675 CAGCATCCATTGTTTCTGTTGGG - Intergenic
1093453678 12:19342947-19342969 CAGAAATTATTTTTTCTTTTGGG + Intronic
1093923770 12:24889150-24889172 CAGAAACAGTTCTTTCTGTAGGG - Intronic
1096370231 12:51063420-51063442 AAGCAGCTATTCTTTCTGTAGGG - Exonic
1097625023 12:61989549-61989571 CAGTAACCATTCTTTCTGAATGG - Intronic
1098766074 12:74490803-74490825 AAGTTGCTATTCTTTCTTTTAGG - Intergenic
1098989807 12:77052742-77052764 ATGTATCTATTCTTTCAGTTCGG - Intronic
1100155606 12:91796564-91796586 CAGAACCAATCCTTTCTGTTTGG - Intergenic
1105044915 12:132994770-132994792 CATCAACTATCATTTCTGTTAGG + Intronic
1105489768 13:20876750-20876772 CAGAACTTATTCTTTCTGGTGGG + Intronic
1106277208 13:28222537-28222559 CATTAATTATTTTTTCTGTTTGG + Intronic
1106292439 13:28376932-28376954 TAGAAACATTTCTTTCTGTTGGG - Intronic
1106855846 13:33851723-33851745 CAGTGACTATTTTTTGTGTAAGG + Intronic
1106968892 13:35111483-35111505 CAGTAATTATTCTTGGGGTTTGG - Intronic
1107079941 13:36364174-36364196 CTGTAACTATCTTTTCTATTTGG + Intronic
1107444904 13:40461450-40461472 CAGTACCTACTCTTTTTGATTGG + Intergenic
1107584139 13:41825521-41825543 TAGAAGCTGTTCTTTCTGTTAGG + Intronic
1109107261 13:58269335-58269357 CAGTAACTTTTGCTTCCGTTAGG - Intergenic
1109321885 13:60820384-60820406 GTGGAACTATTATTTCTGTTAGG + Intergenic
1111251786 13:85610927-85610949 AAGTAATTTGTCTTTCTGTTGGG + Intergenic
1113162817 13:107401668-107401690 AAGTAACAACTATTTCTGTTGGG - Intronic
1113538694 13:111089231-111089253 CAGTAATTATTCTTGGGGTTTGG + Intergenic
1114805944 14:25836917-25836939 CATTACCTATTCTTTCTATGGGG + Intergenic
1115459820 14:33648161-33648183 CAGTAACTTTGCTTCCTGGTGGG - Intronic
1116716192 14:48430345-48430367 CAGTCATTATTGCTTCTGTTGGG - Intergenic
1117185619 14:53237509-53237531 CTGTAACTATTATTTCTTCTTGG - Intergenic
1117603950 14:57405925-57405947 CTGTAATTTTTTTTTCTGTTAGG + Intronic
1118517134 14:66542935-66542957 CAGTCACTATGCTTCCTGTATGG - Intronic
1118575699 14:67239904-67239926 CAGTAACCGTTTTTTCTTTTGGG + Intergenic
1118601996 14:67477327-67477349 CAGGTCCTATTCATTCTGTTAGG + Intronic
1118856884 14:69629905-69629927 CAGTTCCTATTCTTTCTCATAGG + Intronic
1119799641 14:77431713-77431735 CAGTAATCAATCTTTCTTTTGGG + Intronic
1120869486 14:89324236-89324258 CTGTAACTATTGTTTTTGATGGG + Intronic
1121760195 14:96438493-96438515 CAGTAACAATTCTCACTGTCTGG - Intronic
1122260607 14:100518546-100518568 CCTTAAATATTCTTTCTTTTGGG + Intronic
1123484079 15:20668936-20668958 CAGTAATTATTCTTGGGGTTTGG + Intergenic
1126454078 15:48842318-48842340 CAGTGGCTACTGTTTCTGTTAGG - Intronic
1126703828 15:51389433-51389455 CAGTAACTATTTATTCTGGTTGG + Intronic
1130126393 15:81097446-81097468 CACCAACTTTTCTTTCTTTTAGG + Intronic
1131123312 15:89836856-89836878 CAGGAATTCTTCTTTCTGTGAGG - Intronic
1131550062 15:93349641-93349663 CAGAAAATATTATTTCTCTTGGG + Intergenic
1132544146 16:525456-525478 CAGTTTCAGTTCTTTCTGTTTGG + Intergenic
1133213220 16:4274206-4274228 CAGTAACTATTGTTACTAGTAGG - Intergenic
1138703517 16:58890594-58890616 CATTGAGTTTTCTTTCTGTTTGG + Intergenic
1140249436 16:73282933-73282955 CAGGCACTATTCTTAATGTTAGG + Intergenic
1140976588 16:80065388-80065410 AAGTATCTATTCCTTCTATTTGG + Intergenic
1141079410 16:81036832-81036854 CAGTAATTATTCCTACTGATGGG - Intronic
1144014440 17:11180551-11180573 CAGAAACTAATTTTTCTGATAGG + Intergenic
1145775977 17:27528985-27529007 CATTTATTATTCTTTCAGTTTGG + Intronic
1149513450 17:57261350-57261372 CAGTAACTTTTTTTTTTTTTTGG + Intronic
1150246334 17:63678324-63678346 GAGTAACTTTAGTTTCTGTTAGG + Intronic
1152463999 17:80455564-80455586 CAGTAACTTTCCTTTCAGTCAGG - Intergenic
1154121040 18:11652894-11652916 CTGGAACTAATGTTTCTGTTTGG - Intergenic
1155344670 18:24846622-24846644 CAGTAGCAATTCTTTCCTTTGGG + Intergenic
1155761392 18:29572420-29572442 CACTTCCTATTCTTTCTGTCTGG - Intergenic
1156278271 18:35606118-35606140 CAGTAACTGCTCTTTCAGCTTGG - Intronic
1156707654 18:39902363-39902385 AAGTAACTACTCTGTGTGTTTGG - Intergenic
1157154360 18:45250915-45250937 CAGTGAATATTATTTCTGGTAGG - Intronic
1157656885 18:49399258-49399280 AAGTAACTATTCTTCCTGAAGGG + Intronic
1157762985 18:50277820-50277842 CAGTAAGTATGCTTTCCCTTTGG - Intronic
1159495220 18:69194106-69194128 CAGAAGGTTTTCTTTCTGTTTGG - Intergenic
1162003377 19:7762339-7762361 CAGAATGTATTCATTCTGTTTGG + Intergenic
1162754011 19:12846513-12846535 CATTAGCTATTCTTTCTGCTTGG - Intronic
925234023 2:2262120-2262142 CAGACACTATTCTAGCTGTTGGG - Intronic
925470147 2:4152224-4152246 AAGTTACTATTCTTGCTATTAGG + Intergenic
928655354 2:33445768-33445790 CAGTATATACTTTTTCTGTTTGG - Intronic
928698869 2:33878586-33878608 CAGTAAATTTTCTTTCTCTGGGG + Intergenic
930946040 2:57077142-57077164 AAGTAACAATTTTTTCTGCTTGG - Intergenic
936448643 2:112616848-112616870 CAGGAACTATTCCTTCTTTCAGG - Intergenic
937191659 2:120107336-120107358 CAGTTACTATTTTTTATGATTGG + Intronic
938686709 2:133745297-133745319 CAGTAAGTCTTCTTTATGTCTGG + Intergenic
940511420 2:154620138-154620160 CACTAACTATTCTTTTTTTTGGG - Intergenic
941543845 2:166820601-166820623 GGGTAAATATTCTTTCTGTTGGG - Intergenic
941815761 2:169794380-169794402 CAGTAACTTTCCCTTCTGATTGG - Intronic
942173209 2:173307453-173307475 AAGTACCTATTGTTTCTCTTTGG + Intergenic
943452495 2:188061346-188061368 CAGTAATTAATTATTCTGTTTGG - Intergenic
944898146 2:204187175-204187197 CAGTAACTACTGTTATTGTTTGG - Intergenic
945896911 2:215493674-215493696 AAGTTCCTTTTCTTTCTGTTGGG - Intergenic
947680575 2:232028242-232028264 TATTATCTATTCTTTCTGATGGG + Intronic
947892907 2:233642257-233642279 CAGTAATTATTTCTTGTGTTTGG + Intronic
1169182865 20:3585404-3585426 CAATAACCACTTTTTCTGTTGGG - Intronic
1169636924 20:7702667-7702689 CAGTTACTGTTTTTCCTGTTTGG - Intergenic
1170196079 20:13691009-13691031 GAGAAACTATGCTTCCTGTTGGG - Intergenic
1173016835 20:39233516-39233538 CAGTAAATCCTCTTTCTGTCTGG - Intergenic
1173776324 20:45710065-45710087 CAGTAACTATTCTCAATGTTGGG - Intergenic
1177635129 21:23777962-23777984 CAGTAGCTATTCTTTAGGTGTGG - Intergenic
1178201346 21:30409623-30409645 CTAAAATTATTCTTTCTGTTTGG - Intronic
1179002561 21:37477018-37477040 CTGTAACAATTCTGTCTTTTCGG + Intronic
1182116373 22:27758801-27758823 CTGTGACTATACTTTCTATTGGG - Intronic
1183211347 22:36453341-36453363 CAGTAAATATTTATTGTGTTAGG - Intergenic
1183883639 22:40857567-40857589 AAGTAGCTCTTGTTTCTGTTAGG + Intronic
1183920395 22:41162426-41162448 CTGTTACTATTCTTGGTGTTAGG - Intronic
949241026 3:1871865-1871887 CAGTAAAGCTGCTTTCTGTTTGG - Intergenic
951344953 3:21536889-21536911 CAGTGACTCTTCTCTCTGTCTGG - Intronic
951477746 3:23126439-23126461 CAGTAACTGGCCTTTTTGTTAGG - Intergenic
952173936 3:30841064-30841086 CATCAACTATTTTTTCTGCTGGG - Intronic
955953583 3:64266326-64266348 GAGCAACTTTTATTTCTGTTTGG - Intronic
957063101 3:75498245-75498267 TAGTAACTTTTTTTTTTGTTGGG - Intergenic
957191986 3:77021559-77021581 GTGTAACTATCCTTCCTGTTGGG - Intronic
957334734 3:78812417-78812439 CAGTTACAATTCTTTCTTTTTGG + Intronic
957800571 3:85074539-85074561 CAGGAACTATTCTAACTGCTTGG - Intronic
957900194 3:86480035-86480057 CAGTAACCAATCTATATGTTAGG - Intergenic
959316059 3:104808647-104808669 CAGCAAATATTCTTCCTGCTTGG - Intergenic
959551605 3:107665829-107665851 CAGTATTGATTCTTTCTGTTGGG + Intronic
959628518 3:108481600-108481622 CACTAACTCTTCTTTCTGCCTGG - Intronic
959952178 3:112192613-112192635 CAGAAATTATTTTTTCTGCTTGG + Intronic
960885679 3:122391749-122391771 CATTTATAATTCTTTCTGTTTGG + Intronic
963030017 3:140960914-140960936 CTGCAACCATTCTATCTGTTTGG - Intronic
964056066 3:152459665-152459687 CAGTAAGTATTTTTGCTGTGTGG + Intronic
966347371 3:178994262-178994284 CAGGAAATATCCATTCTGTTTGG - Intergenic
966475935 3:180346828-180346850 CAGTAATTATTTTCTCTGGTTGG + Intergenic
966486348 3:180475331-180475353 CAGAAACTATTTTGTCTGTCTGG + Intergenic
966621290 3:181966978-181967000 CAATATCTACTTTTTCTGTTAGG - Intergenic
967097216 3:186186956-186186978 AACCAACTATTCTTTCTGTCTGG - Intronic
967295573 3:187961411-187961433 CACTTACTTTTCCTTCTGTTTGG - Intergenic
968508071 4:981254-981276 CAGTATCTTTTCGTTCTTTTTGG + Intronic
971041003 4:22752128-22752150 CAGAAACTTTTCCTTATGTTTGG + Intergenic
971991970 4:33910073-33910095 CAGAGACTATTATTTCTCTTTGG - Intergenic
972174237 4:36383767-36383789 CAGAAACTACTCTCTATGTTTGG + Intergenic
973812805 4:54588627-54588649 CAGCAAATATTCTTTCTGAGAGG + Intergenic
973906266 4:55534666-55534688 CAGCTACTATTCTGTCTGCTGGG - Intronic
974649486 4:64735415-64735437 CAGGAAATATTCTCTCTGTAGGG + Intergenic
975076536 4:70216233-70216255 GAGTAATTATTCTTTCTAGTTGG + Intergenic
975076997 4:70222069-70222091 GAGTAATTATTCTTTCTAGTTGG - Intergenic
975763259 4:77638676-77638698 AAGTAACTCTTCATTTTGTTGGG + Intergenic
976509940 4:85896736-85896758 CAATAGTCATTCTTTCTGTTTGG + Intronic
976947108 4:90783692-90783714 CAGTAAGAATTCTTTCTCCTTGG - Intronic
979172475 4:117619631-117619653 GATTAATTATTCTTTCTGTCAGG - Intergenic
979189459 4:117838195-117838217 CAGTATTTATTTTCTCTGTTGGG - Intergenic
979768278 4:124490079-124490101 CAGCAAGTTTTCTTTCTCTTCGG + Intergenic
982062896 4:151622525-151622547 CAGTAAGTATCTTTTCTGCTTGG + Intronic
983657784 4:170100260-170100282 CAGAAACAATTCTTTGAGTTAGG + Intergenic
984120803 4:175740543-175740565 AATTAATTTTTCTTTCTGTTGGG - Intronic
984994165 4:185412287-185412309 AAGGAACTATTCTTTTTGTGAGG + Intronic
985232515 4:187836351-187836373 CATTAGCTATTCTTCCTGATAGG + Intergenic
986029266 5:3880344-3880366 CAGTGGCCATTCTTTCTCTTGGG - Intergenic
986975012 5:13383652-13383674 CAGGAACTCTTCCTTCTGCTTGG - Intergenic
987329757 5:16846197-16846219 CAATAGCTTGTCTTTCTGTTTGG - Intronic
989091668 5:37740360-37740382 TTGTAGCTATTCTTTCTTTTTGG - Intronic
989161104 5:38392609-38392631 CAGAATCTATTCTTTTTTTTTGG + Intronic
989227562 5:39047614-39047636 CAAAAACTATTATTTCTTTTAGG + Intronic
989704994 5:44319165-44319187 CAGAAACAATTCATTCTATTTGG + Intronic
989729862 5:44636120-44636142 GAGCAACTATTCATTCTGTCTGG + Intergenic
992028801 5:72699643-72699665 CACTATCTAATCTTTTTGTTTGG + Intergenic
993388433 5:87288225-87288247 CATTTACTATTTCTTCTGTTGGG + Intronic
994366390 5:98922458-98922480 TTTTAACTATTCTTTCTGTCTGG - Intronic
994691614 5:103026655-103026677 CAGAAACTATTATTTGTGCTGGG - Intronic
995293014 5:110482231-110482253 CAGTAAATTTTCTTTCTGGATGG - Intronic
997279125 5:132627543-132627565 CAGTAACTATTCTCTCTACCTGG - Intronic
998485056 5:142494699-142494721 CAGTAACTACTATTTATGTGAGG + Intergenic
1000342468 5:160288300-160288322 CAGTTACTATGTTTTCAGTTTGG + Intronic
1000475483 5:161701450-161701472 CAATATCTATTCTTTCATTTGGG + Intronic
1000743270 5:164996797-164996819 CAGTAACTATTTTTTAATTTGGG - Intergenic
1001817399 5:174681491-174681513 CATTAACTAGTATTTCTGCTTGG - Intergenic
1002578638 5:180193622-180193644 CTGTAACAGTTCTTTTTGTTTGG - Intronic
1008017366 6:46535921-46535943 CAACCAATATTCTTTCTGTTAGG + Intergenic
1009268286 6:61585703-61585725 CAGCATCTATTCTATCTCTTGGG + Intergenic
1009513669 6:64585599-64585621 CAGTAAATAATCTTTCTCTATGG + Intronic
1013720064 6:113014509-113014531 CAGTTAGTATTCTTTTTGGTGGG + Intergenic
1014624343 6:123707678-123707700 CAGCAGCTATTCTATCTGCTGGG + Intergenic
1014646107 6:123975142-123975164 CATTAGCTATTCTTTCTCTAAGG + Intronic
1015151796 6:130048083-130048105 CAATAATTATTCTTTCTATCAGG - Intronic
1015208927 6:130673121-130673143 CAGTAACTATTGGTTCATTTTGG - Intergenic
1015728173 6:136320911-136320933 CAGTATGTATTTTTTCTGTCTGG - Intergenic
1016511197 6:144845265-144845287 CAGTAACTATTTTTATTTTTTGG + Intronic
1018786463 6:167112169-167112191 CAGCATCTCTTCTTTCTTTTTGG - Intergenic
1018909731 6:168095086-168095108 CAGTCACTCTCCCTTCTGTTAGG - Intergenic
1023431971 7:40102930-40102952 CATTAATAATTTTTTCTGTTTGG - Intergenic
1024265621 7:47604232-47604254 CAGAATTTATTCTTTCTGGTGGG - Intergenic
1024333777 7:48182824-48182846 CTGTAACTATAGTTGCTGTTTGG + Intronic
1024477247 7:49826171-49826193 CAATAATTATTCCTTCTGTCTGG + Intronic
1028799121 7:94941602-94941624 CAGCAACTATTTTTTTTTTTTGG + Intronic
1028902204 7:96114168-96114190 CACTGACTATTCTGTCTCTTTGG - Intergenic
1030876408 7:114818625-114818647 TAGTTACTATTCTTTCTGTGTGG - Intergenic
1031355623 7:120783286-120783308 CATTACCCATTCTTTCTGTGTGG + Intergenic
1031578364 7:123442680-123442702 CAGTATCTGTTCTTTCTGACAGG + Intergenic
1032789675 7:135233164-135233186 AAGTAGGTATTCTTTCAGTTTGG - Intronic
1033857026 7:145575984-145576006 TTGTAAGAATTCTTTCTGTTTGG + Intergenic
1035111950 7:156490493-156490515 CAGCAATGATTATTTCTGTTTGG + Intergenic
1037310212 8:17547480-17547502 AAGTATCTATTTTTTCTATTAGG - Intronic
1037513704 8:19609577-19609599 CAGTATGTATTCTATTTGTTGGG - Intronic
1038464340 8:27746991-27747013 AAGTAACTCTTTTTTCTTTTTGG + Intronic
1041632843 8:60107375-60107397 CACTTACTATTTTTTATGTTGGG + Intergenic
1042367969 8:67958259-67958281 CAGTAGAGATTCTTTCAGTTGGG + Intronic
1043172714 8:76985704-76985726 CAGTAACTATTCTTTCTGTTAGG - Intronic
1043879701 8:85528586-85528608 CAGGAACAATTCTACCTGTTGGG - Intergenic
1044542201 8:93420549-93420571 CACTAACTAGTCTTTCCTTTAGG + Intergenic
1045270816 8:100659706-100659728 CAGTAATTACTCTTTGTCTTGGG - Intronic
1045851147 8:106699199-106699221 CACGAACTATTCTTACTGTGTGG + Intronic
1046236477 8:111429774-111429796 CAGTAACTAATAATTCTGTCAGG - Intergenic
1046685162 8:117216808-117216830 TAGTAAGTATTCTTTTGGTTTGG + Intergenic
1047260293 8:123251923-123251945 CAGGCACTATTCTTACTGCTTGG - Intronic
1047679438 8:127239272-127239294 GGGTAACTATTCTCTCTGTTGGG - Intergenic
1047887109 8:129263685-129263707 GAGTAAATATTCATTCTCTTTGG - Intergenic
1048059725 8:130905962-130905984 AATGAACTATTCTTTCTGTAAGG - Intronic
1048825964 8:138427037-138427059 CAGTATATATTTTTTCTGTTTGG - Intronic
1049116409 8:140692312-140692334 GAGAATCTATTCTTTCTGATTGG - Intronic
1049598111 8:143493857-143493879 CAGTAAATATTGATTCAGTTGGG - Intronic
1050489706 9:6175443-6175465 ATGTATCTTTTCTTTCTGTTGGG - Intergenic
1050744776 9:8862713-8862735 CAGCATCTCTTCTTGCTGTTAGG + Intronic
1050974256 9:11916519-11916541 CAGTAACAATTTTCTGTGTTAGG + Intergenic
1051064210 9:13082413-13082435 CAGTAAGTATTCTTTTTGTATGG - Intergenic
1051757179 9:20414807-20414829 CGGGAACTATTAATTCTGTTGGG + Intronic
1053100618 9:35369213-35369235 AAGTACCTACTTTTTCTGTTGGG + Intronic
1053569956 9:39294181-39294203 CAATAACTATTCTTACCGGTAGG - Intergenic
1053654696 9:40205010-40205032 CAGTAATTTTTCTTGCTGATGGG + Intergenic
1053905084 9:42834216-42834238 CAGTAATTTTTCTTGCTGATGGG + Intergenic
1054091585 9:60853183-60853205 CAATAACTATTCTTACCGGTAGG - Intergenic
1054113000 9:61128757-61128779 CAATAACTATTCTTACCGGTAGG - Intergenic
1054127193 9:61324829-61324851 CAATAACTATTCTTACCGGTAGG + Intergenic
1054366811 9:64351227-64351249 CAGTAATTTTTCTTGCTGATGGG + Intergenic
1054529900 9:66171300-66171322 CAGTAATTTTTCTTGCTGATGGG - Intergenic
1054674440 9:67840969-67840991 CAGTAATTTTTCTTGCTGATGGG + Intergenic
1055576376 9:77663779-77663801 CAGTGATTTTTGTTTCTGTTTGG + Intergenic
1055670770 9:78603947-78603969 CAAACATTATTCTTTCTGTTGGG - Intergenic
1057434137 9:95023729-95023751 CAGTAACTATTATTCTTGTGTGG + Intronic
1057530261 9:95838753-95838775 CATTAACTAGGCTTTCTGTTAGG + Intergenic
1058210628 9:102164264-102164286 CAGGAAATATTTTTTCTGTGGGG - Intergenic
1185970068 X:4652816-4652838 CAATAAATATTCTTTCTGGAAGG - Intergenic
1186081116 X:5933267-5933289 CAATAACTATAATTTCTATTTGG + Intronic
1188863923 X:35291016-35291038 CACTAACTCTTCTTTCAGTTTGG + Intergenic
1189644573 X:43114032-43114054 CAGGAACTATACTTTGAGTTAGG + Intergenic
1189827000 X:44929414-44929436 CAGTATGTATTCTTTTTGTCTGG + Intronic
1190914539 X:54800792-54800814 CAATGACTGTTCTTTCTGCTTGG + Intergenic
1191164057 X:57368238-57368260 CACTAACTATTCTCTGGGTTTGG - Intronic
1192277945 X:69652578-69652600 CAGTAAAGCTACTTTCTGTTGGG - Intronic
1192722383 X:73712691-73712713 CACTAACTCCTCTTTCTATTTGG - Intergenic
1195931732 X:110084638-110084660 CAACAACTATTCTTTATTTTTGG - Intronic
1196136494 X:112215243-112215265 CATTATCTTTTCTTTGTGTTGGG + Intergenic
1196144310 X:112299813-112299835 AAGTAACTTTTCAATCTGTTAGG - Intergenic
1197368288 X:125594444-125594466 CACTAACTTTTCTTTAAGTTTGG + Intergenic
1197449794 X:126597814-126597836 CCGTGACTATTCTCTGTGTTTGG + Intergenic
1197943873 X:131817381-131817403 CAGACACTAATCTTTTTGTTTGG + Intergenic
1199949123 X:152691894-152691916 CAGCTACTATTTTTGCTGTTAGG + Intergenic
1199960553 X:152776555-152776577 CAGCTACTATTTTTGCTGTTAGG - Intergenic
1200734107 Y:6775401-6775423 CAGAAAATATCCTTTCTGTAGGG - Intergenic
1200815754 Y:7530590-7530612 AACTATCTTTTCTTTCTGTTGGG + Intergenic
1201343304 Y:12956624-12956646 CAGTAACTTTACTTTATCTTGGG + Intergenic
1201757662 Y:17504224-17504246 CACTAACTGTTCTCTCTGTGAGG + Intergenic
1201843892 Y:18401758-18401780 CACTAACTGTTCTCTCTGTGAGG - Intergenic