ID: 1043172719

View in Genome Browser
Species Human (GRCh38)
Location 8:76985726-76985748
Sequence GAGGGAGGCATGGATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043172711_1043172719 17 Left 1043172711 8:76985686-76985708 CCTTTAAAAAGCCAATACCCTAA 0: 1
1: 0
2: 4
3: 18
4: 262
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172713_1043172719 0 Left 1043172713 8:76985703-76985725 CCCTAACAGAAAGAATAGTTACT 0: 1
1: 0
2: 0
3: 30
4: 236
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172714_1043172719 -1 Left 1043172714 8:76985704-76985726 CCTAACAGAAAGAATAGTTACTG 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data
1043172712_1043172719 6 Left 1043172712 8:76985697-76985719 CCAATACCCTAACAGAAAGAATA 0: 1
1: 0
2: 0
3: 8
4: 233
Right 1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043172719 Original CRISPR GAGGGAGGCATGGATCCTGC TGG Intronic
No off target data available for this crispr