ID: 1043178821

View in Genome Browser
Species Human (GRCh38)
Location 8:77057805-77057827
Sequence GCTGCCAGGAAGCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043178818_1043178821 -9 Left 1043178818 8:77057791-77057813 CCCTGGTTCTACAGGCTGCCAGG No data
Right 1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG No data
1043178820_1043178821 -10 Left 1043178820 8:77057792-77057814 CCTGGTTCTACAGGCTGCCAGGA No data
Right 1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG No data
1043178817_1043178821 -8 Left 1043178817 8:77057790-77057812 CCCCTGGTTCTACAGGCTGCCAG No data
Right 1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043178821 Original CRISPR GCTGCCAGGAAGCACTGTGC TGG Intergenic
No off target data available for this crispr