ID: 1043189413

View in Genome Browser
Species Human (GRCh38)
Location 8:77199382-77199404
Sequence ATTTTGTCTTTTGAGATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043189413_1043189414 -8 Left 1043189413 8:77199382-77199404 CCGTTGATCTCAAAAGACAAAAT No data
Right 1043189414 8:77199397-77199419 GACAAAATTCAGTGCTGTAAAGG No data
1043189413_1043189415 -2 Left 1043189413 8:77199382-77199404 CCGTTGATCTCAAAAGACAAAAT No data
Right 1043189415 8:77199403-77199425 ATTCAGTGCTGTAAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043189413 Original CRISPR ATTTTGTCTTTTGAGATCAA CGG (reversed) Intergenic
No off target data available for this crispr