ID: 1043195460

View in Genome Browser
Species Human (GRCh38)
Location 8:77287199-77287221
Sequence GGTGCTGTTGCAACACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043195453_1043195460 20 Left 1043195453 8:77287156-77287178 CCATACCTGCTCCAATCTTGGAG No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195454_1043195460 15 Left 1043195454 8:77287161-77287183 CCTGCTCCAATCTTGGAGCAAAG No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195452_1043195460 21 Left 1043195452 8:77287155-77287177 CCCATACCTGCTCCAATCTTGGA No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195455_1043195460 9 Left 1043195455 8:77287167-77287189 CCAATCTTGGAGCAAAGTTGAGG No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195450_1043195460 26 Left 1043195450 8:77287150-77287172 CCACTCCCATACCTGCTCCAATC No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195448_1043195460 28 Left 1043195448 8:77287148-77287170 CCCCACTCCCATACCTGCTCCAA No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data
1043195449_1043195460 27 Left 1043195449 8:77287149-77287171 CCCACTCCCATACCTGCTCCAAT No data
Right 1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043195460 Original CRISPR GGTGCTGTTGCAACACAGCC AGG Intergenic
No off target data available for this crispr